40 likes | 177 Views
Q1: The process of making RNA using a DNA template is called: Transformation Translation Transposition Transcription Transduction. Q2: The process of making protein using an RNA template is called: Transformation Translation Transposition Transcription Transduction.
E N D
Q1: The process of making RNA using a DNA template is called: Transformation Translation Transposition Transcription Transduction
Q2: The process of making protein using an RNA template is called: Transformation Translation Transposition Transcription Transduction
Q3: Consider the following segment of DNA, where the bases in bold are a promoter. Transcription initiates at the position indicated by underlined base pair and terminates at the boxed base pair. 5’ …CAAACGTCTAGTGATGCATGGTATCATAAGGAGGCTGATGTACAAGCATTGACCGT… 3’ 3’ …GTTTGCAGATCACTACGTACCATAGTATTCCTCCGACTACATGTTCGTAACTGGCA… 5’ | | | | | 1 10 20 30 40 What RNA molecule(s) is produced when RNA polymerase makes a transcript(s) from this promoter? A) 5’ CAAACGUCUAGUGAUGCAUGGUAUCAUAAGGAGGCUGAUGUACAAGCAUUGACCG 3’ B) 5’ AUAAGGAGGCUGAUGUACAAGCAUUGACCG 3’ C) 5’ UAUUCCUCCGACUACAUGUUCGUAACUGGC 3’ 3’ GUUUGCAGAUCACUACGUACCAUAGU 5’ D) E) All of the above
Q4: Consider the following mRNA: 5’ AUA AGG AGG CUG AUG UAC AAG CAU UGA CCG 3’ What amino acid sequence could be made from this mRNA? A) C-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-Pro-N B) C-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-N C) N-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-C D) C-Met-Tyr-Lys-His-N E) N-Met-Tyr-Lys-His-C