170 likes | 287 Views
Protein Synthesis. DNA. Double stranded Complimentary Composed of Nucleotides. DNA replication. DNA Helicase – breaks hydrogen bonds holding complimentary strands together Forms replication fork Leading strand Lagging strand. DNA Replication. DNA is read 5’ to 3’. Leading Stand.
E N D
DNA • Double stranded • Complimentary • Composed of Nucleotides
DNA replication • DNA Helicase – breaks hydrogen bonds holding complimentary strands together • Forms replication fork • Leading strand • Lagging strand
DNA Replication DNA is read 5’ to 3’
Leading Stand • Helicase -> RNA pimase -> DNA polymerase
Lagging Stands • Helicase -> RNA primase -> DNA polymerase -> okazaki fragments -> DNA polymerase cleans up RNA primase strand -> DNA ligase
Movie • Replication • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__dna_replication__quiz_1_.html • http://www.hhmi.org/biointeractive/dna-replication-advanced-detail
Protein Synthesis 2 parts • Transcription • To copy segment of DNA • Translation • To translate the language of nitrogenous bases into amino acids
RNA vs. DNA • Difference between mRNA and DNA • Single stranded vs. Double stranded • The sugar has an extra oxygen, ribose vs. deoxyribose • Uses uricil “U” instead of thymine
Transcription • Production of mRNA • RNA primase binds to DNA at a promoter region • RNA polymerase adds bases copying the gene
Movie • Transcription • http://www.dnalc.org/resources/3d/13-transcription-advanced.html
Packaged • mRNA is processed to leave the nucleus • Extras are cut out • Splicosomes • Introns • Exons • Poly-A tail • 5’ cap
Translation • mRNA has left the nucleus. • Binds with ribosome • mRNA -> tRNA -> amino acids -> folded proteins • What’s the Problem? • mRNA • UGGCUUGCAUGCCGGAGUCCACGUAAUCA Into • Amino acids A G C U Amino Acids
Translation • tRNA consists of a • Anticodon– 3 bases that match codon • Amino acid • Codon – 3 base sequence on mRNA
Translation • mRNA -> tRNA -> amino acids -> proteins
Translation • mRNA • UGGCUUGCAUGCCGGAGUCCACGUAAUCA
Movie • Translation • http://www.hhmi.org/biointeractive/translation-basic-detail