330 likes | 428 Views
Embark on an interactive journey to unravel the mysteries of protein synthesis through a theatrical play involving tRNAs, ribosomes, and mRNA. Learn about nucleic acids and proteins' vital functions in cells. Discover how amino acids form polypeptides and proteins, influencing cellular activities. Explore protein folding and denaturation, hemoglobin's role in oxygen transport, and the impact of sickle cell anemia. Dive into the intricacies of molecular biology through a captivating performance.
E N D
Who knows the code? - Take one • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon
Choreographing translation • A play of many parts, many players • Let us do this quickly! But a reminder…
Roles • 4 tRNA (1-2 people) • 4 teams to be synthetases (1-2 people) • 1 group to be the ribosome (~3 people) • 1 group to be (RNA polymerase + mRNA) (~3 peeps) • 1 termination factor (1-2 people)
Learning your ‘lines’ • Handout: Each group find the questions related to their role and answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts…
DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’
DNA template strand(alternate version) 5’ CTTAAATCCGAATGCCCATG 3’
Special powers • Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can inspect ALL of the mRNA and help ribosome to assemble
Going with the flow • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops,molecules involved will announce, explain • Go until a protein happens *This includes non-events (rejections, etc.)
Who knows the code? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon
First some lovely terminology - Nucleic Acids • Monomer: nucleotides (pentose sugar + phosphate + purine/pyrimidine base)
Nucleic Acids • Primary Biological Function: information storage cellbio.utmb.edu/cellbio/ribosome.htm
Proteins • Amino acids are linked together by peptide bonds to form one or more macromolecule subunits called polypeptides. Long chains of polypeptides result in the formation of proteins. The primary amimo acid sequence of a protein determines its secondary, tertiary, and quaternary structure, which then in turn determines its functional state.
Or yet to say it another way • It’s important to note that each amino acid in the chain can be thought of having certain gross chemical features. For example, these may be hydrophobic, hydrophilic, or electrically charged. • These variables interact with each other and their surroundings in the cell to produce a well-defined, three dimensional shape. • The native state of a protein refers to it’s functional or operative form.
Proteins • Monomer: AMINO ACIDS • Covalent Bond: PEPTIDE BOND
Proteins • Primary Biological Functions: NUMEROUS INTRACELLULAR ROLES; CATALYSIS (speeding up chemical reactions)
Proteins • Key Examples: enzymes (catalysts); membrane transporters (bind and allow passage of certain molecules into cells); signaling proteins
You should know… • Protein folding, oil not mixing with water, and membrane formation all reflect the same principle • In protein folding, the constraint is that the individual units are all attached to a pair of neighbors • Many proteins need no further ‘instruction’ than their sequence & water to correctly assume their superhero identity
Proteins & structure Essential biology, 2nd ed.
Proteins • Proteins denatured by heat, alterations in pH, or certain chemicals lose tertiary and secondary structure.
Proteins • Oxygen reversibly bound to hemoglobin in red blood cells • Each molecule of hemoglobin can carry a maximum of four molecules of O2
Proteins • Affinity of hemoglobin for O2 depends on PO2 to which hemoglobin is exposed • hemoglobin picks up O2 as it flows through respiratory exchange structures and gives up O2 in metabolically active tissues • The affinity of hemoglobin for O2 is decreased by the presence of hydrogen ions or metabolites of glycolysis
Proteins • Myoglobin has a high affinity for O2 and serves as an O2 reserve in muscle • Fetal hemoglobin has a higher affinity for O2 than does maternal hemoglobin, allowing fetal blood to pick up O2 from the maternal blood in the placenta
www.defiers.com/scd.html Proteins • Sickle cell anemia = 2 hydrophobic spots (one arising via mutation) get stuck together in presence of water • New sticky spots make hemoglobins form GIANT chains; these deform RBC, reduce their flexibility, and cause them to get trashed in tiny vessels, loss of too many RBC => not enough O2 transport = anemia. Bad news!!!
Seventy Great Mysteries of the Natural World Thames & Hudson p. 112
Seventy Great Mysteries of the Natural World Thames & Hudson p. 112 The real structure – Beautiful !
Hemoglobin tutorial • Read the instructions on the intro... • Read the instructions on each question... • Read the instructions on the webpage... • Read all the words of each question... • ... or gnash your teeth in frustration & futility!
Different tools; different jobs • Your group has an amino acid; which is it? • In what ways are all bases identical? Different? • In what ways are all amino acids identical? Different? • Which group is more diverse in terms of ‘feel’? • Which is more diverse in terms of shape? • Which would allow you to build more diverse shapes & surfaces?
Homework for next week • Assessor: “Chimeric Dictyostelium Paper” • Same deal as before – find the paper and read (or scan) it. Do the assignment before next class.
More paper fun! • Introduction to the scientific literature • It really is important that you know how to navigate one of these things, besides – it’s probably one of the easier Assessor type assignments! (if there is possibly such a thing)
Why read ? • Rather than always reproducing everything ever done, past work is filtered and ‘accepted’ • Accessing this body of knowledge can be a source of inspiration, insight, inquisitiveness • buyer beware: both the writing and the reviewing of papers is done by real people with the requisite strengths & weaknesses
For 181 Lab • A paper about an organism that you will be experimenting with • An introduction to the biology and study of the organism • A homework assignment requiring you to read, understand