Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
The Case of the Crown Jewels: PowerPoint Presentation
Download Presentation
The Case of the Crown Jewels:

The Case of the Crown Jewels:

135 Views Download Presentation
Download Presentation

The Case of the Crown Jewels:

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. The Case of the Crown Jewels: Investigate a Crime Scene Using DNA Restriction Analysis (DNA Fingerprinting) Module developed at Boston University School of Medicine Presented by Dr. Dan Murray

  2. Outline • DNA Structure • Restriction Enzymes • DNA Fingerprinting • Simple Tandem Repeats (STRs) • DNA Synthesis • Polymerase Chain Reaction (PCR)

  3. DNA Structure

  4. What is DNA made of? Nucleotides: Phosphate Sugar Base Carbon atoms of sugar are numbered

  5. Nucleotide 1 Nucleotide 2 Nucleotide 3 Nucleotide 4 = one strand of DNA Note polarity

  6. P S P S P S P S Nucleotide 1 T Nucleotide 2 A Nucleotide 3 C Nucleotide 4 G one strand of DNA

  7. 5’ P S P S P S P S 3’ P S P S P S P S T C A G C T G A 3’ 5’ • Two strands of DNA • Double-stranded DNA • Anti-parallel • Hydrogen bonds • AT or GC pairs

  8. 5’ P S P S P S P S 3’ P S P S P S P S T C A G C T G A 3’ 5’

  9. Restriction Enzymes

  10. Restriction endonucleases • Also called restriction enzymes • Occur naturally in bacteria • Hundreds are purified and available commercially • Named for bacterial genus, species, strain, and type • Example: EcoRI • Genus: Escherichia • Species: coli • Strain: R

  11. Restriction endonucleases • Recognize specific base sequences in DNA • Cut DNA at those recognition sites

  12. Restriction Enzyme Recognition Site • Enzymes recognize specific 4-8 bp sequences • EcoRI 5’…GAATTC…3’ • 3’…CTTAAG…5’ • Recognition sites have symmetry • Some enzymes cut in a staggered fashion • Some enzymes cut in a direct fashion • PvuII 5’…CAGCTG…3’ • 3’…GTCGAC…5’

  13. Products generated by restriction enzymes COHESIVE END CUTTERS (staggered cuts): EnzymeRecognition SiteEnds of DNA After Cut EcoRI 5’…GAATTC…3’ 5’…G AATTC…3’ 3’…CTTAAG…5’ 3’…CTTAA G…5’ PstI 5’…CTGCAG…3’ 5’…CTGCA G…3’ 3’…GACGTC…5’ 3’…G ACGTC…5’ BLUNT END CUTTERS (direct cuts): EnzymeRecognition SiteEnds of DNA After Cut HaeIII 5’…GGCC…3’ 5’…GG CC…3’ 3’…CCGG…5’ 3’…CC GG…5’

  14. Frequency of cutting • Average distance between cuts is: • 4n • where “n” is number of bp’s in recognition site. • 4-base cutter: 44 = 256 bp • 5-base cutter: 45 = 1,024 bp • 6-base cutter: 46 = 4,096 bp • 8-base cutter: 48 = 65,536 bp

  15. DNA Fingerprinting

  16. DNA Fingerprinting Determination of an individual’s unique collection of DNA restriction fragments

  17. How to do DNA FingerprintingThe Big Picture Collect Tissue Sample >20 cells >1000 cells RFLP / Southern blot RFLP / Southern blot PCR Analysis

  18. RFLP Analysis RFLP – Restriction Fragment Length Polymorphism; for related DNA molecules, a difference in DNA fragment sizes after restriction enzyme digestion • Difference results from presence of different DNA sequences • Certain regions of genome are highly variable

  19. A single nucleotide change can make a difference Wild-type allele AGATCT TCTAGA Restriction site Mutant allele AGAGCT TCTCGA Not a restriction site

  20. Example: Sickle-cell allele destroys an MstII site

  21. Need to Analyze only a Small Fraction of Genome • Human genome is too big to analyze: • 3 x 109 base pairs  65,536 bp between cuts • = ~46,000 bands • Most regions of genome are not suitable: • 99.9% of DNA sequence is same from one person to the next • Solutions: • Limit analysis to a few genomic regions • Focus on regions which are highly variable

  22. probe GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ATGGCATGGACC How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest ::::::::::::::::::::::::::::::::::::::::: :::::::::::: CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest

  23. Southern Blotting

  24. Simple Tandem Repeats (STRs)

  25. Simple Tandem Repeats(STR’s) STR – region of DNA containing tandem copies of di-, tri- or tetranucleotide repeat units. Examples: Dinucleotide repeats: GTGTGTGTGTGT…… Trinucleotide repeats: ACGACGACGACG…… Tetranucleotide repeats: TATCTATCTATC……

  26. More on STRs • Number of repeats varies greatly between individuals • STRs make up 10-15% of the mammalian genome • STRs are also called “microsatellites” • STRs are “junk DNA”

  27. 100 ACT repeats Person 1 ACTACT ACTACT EcoRI EcoRI 400 ACT repeats Person 2 ACTACT ACTACT EcoRI EcoRI Regions of Chromosome Analyzed for DNA Fingerprinting Often Contain STRs EcoRI fragment from Person 2 is 900bp longer than in Person 1

  28. DNA Synthesis

  29. 5 3 5 3 A G T C A G - - - - - - T C A G T C A G T C A G T C A G T C Separate strands Add correct bases 3 3 5 5 5 3 5 5 5 3 3 A G T C A G A G T C A G - - - - - - T C A G T C A G T C A G - - - - - - T C A G T C - - - - - - A G T C A G T C - - - - - - T C A G T C 3 3 3 5 3 5 3 5 5 DNA Replication is Semi-Conservative

  30. Building a Strand of DNA • DNA polymerase – enzyme that synthesizes DNA • DNA polymerase can only add nucleotides to the 3´ end of a strand • DNA polymerase cannot build a new strand without a primer

  31. ss DNA 3´ 5´ DNA Polymerase Needs a Primer + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis

  32. primer 5´ 3´ DNA Polymerase Needs a Primer ss DNA 3´ 5´ + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis DNA synthesis

  33. DNA Polymerase Needs a Primer primer 5´ ss DNA 3´ 5´ + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis

  34. Polymerase Chain Reaction (PCR)

  35. How to do DNA FingerprintingThe Big Picture Collect Tissue Sample >1000 cells >20 cells RFLP / Southern blot PCR Analysis PCR Analysis

  36. PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication Components in PCR reaction – Target DNA, nucleotides, DNA polymerase, and primers Temperature cycling – DNA replication controlled by temperature…

  37. Temperature Cycling in PCR Temperature cycling – PCR process uses a machine (thermocycler) in which PCR reaction goes through ~30 cycles of three different temperature changes: ~95ºC – Melting temperature 50-65ºC – Annealing temperature 72ºC – Extension temperature

  38. Polymerase chain reaction (PCR) analysis • 1). primers are designed to flank the region to be amplified in target DNA • 2). primers are annealed to denatured DNA • 3). DNA is synthesized using Taq polymerase (from Thermus aquaticus) • 4). primers are annealed again and the process is repeated through • 20-30 cycles, geometrically amplifying the target sequence • 5). DNA is analyzed by gel electrophoresis 1). 2). 3).

  39. 4).