akasma
Uploaded by
89 SLIDES
1076 VIEWS
890LIKES

Chapter 20

DESCRIPTION

Chapter 20. DNA Technology and Genomics. Understanding and Manipulating Genomes.

1 / 89

Download Presentation

Chapter 20

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 20 DNA Technology and Genomics

  2. Understanding and Manipulating Genomes • DNA technology has launched a revolution in the area of Biotechnology which is the manipulation of organisms or their components to make useful products such as insulin, blood clotting factors, and lots of other proteins. • This manipulation can be accomplished by DNA Technology and this would be central to the field of Genetic engineering.

  3. DNA technology is now applied in areas ranging from agriculture to criminal low with the most important achievements in basic research. • For instance the level of expression of thousands of different genes can now be measured at the same time using what is known as DNA microarray (Figure 20.1). • One of the great achievements of modern science has been completing the sequence of the entire human genome by the year 2003.

  4. Figure 20.1 DNA microarray revealing expression of 2400 genes

  5. Concept 20.1: DNA cloning permits production of multiple copies of a specific gene or other DNA segment • To work directly with specific genes • Scientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloning.

  6. DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the laboratory • Share certain general features, such as the use of bacteria (e.g Escherichia coli) and their plasmids.

  7. Overview of Gene Cloning • Isolation of plasmid DNA from bacteria and DNA carrying a gene of interest from another • A piece of DNA containing the gene is inserted into a plasmid (cloning vector) producing a recombinant DNA plasmid • The recombinant plasmid is returned to a bacterial cell • The cell is then grown in culture forming a clone of cells. With the foreign DNA replicating with the rest of the bacterial chromosome. • Identification of the bacterial clone that carries the gene of interest • Once the clone is identified, then a large scale production of the product of the gene is initiated in a bioreactor.

  8. Cell containing geneof interest Bacterium Gene inserted into plasmid 1 Gene of interest Plasmid Bacterialchromosome DNA ofchromosome RecombinantDNA (plasmid) Plasmid put into bacterial cell 2 Recombinatebacterium Host cell grown in culture,to form a clone of cellscontaining the “cloned”gene of interest 3 3 Gene of interest Protein expressedby gene of interest Copies of gene Basic research and various applications Protein harvested 4 Basic research on gene Basic research on protein Gene used to alterbacteria for cleaningup toxic waste Human growth hormone treatsstunted growth Gene for pestresistance inserted into plants Protein dissolvesblood clots in heartattack therapy Figure 20.2 Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes

  9. Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes • Revolutionize the recombinant DNA Technology • Cut DNA molecules at a limited number of specific DNA sequences, called restriction sites • Naturally these enzymes protect bacteria from intruding DNA, but how can they spare the bacterial own DNA? • It adds a methyl group to adenine or cytosine within the sequences recognized by these enzymes.

  10. How can these enzymes be used for creating a recombinant DNA? • A restriction enzyme will usually make many cuts in a DNA molecule • Yielding a set of restriction fragments • The most useful restriction enzymes cut DNA in a staggered way • Producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragments • DNA ligase is an enzyme • That seals the bonds between restriction fragments

  11. Restriction enzymes… Cont. • Most restriction sites are symmetrical; the same 5’→ 3’ sequence of four to eight nucleotides is found on both strands. • Restriction enzymes cut covalent phosphodiester bonds of both strands and always in a very reproducible way producing restriction fragments with at least one single stranded end called sticky end. • Sticky ends will form H-bonded bp with complementary single stranded DNA from another DNA of anther organism that was cut using the same enzyme. • An enzyme called the DNA ligase will seal these fragments together by forming phosphdiester bonds.

  12. 1 3 2 Restriction site 5 3 DNA G A A T T C 3 5 C T T A A G Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow A A T T C G C T T A A G Sticky end A A T T C DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. G G C T T A A Fragment from differentDNA molecule cut by thesame restriction enzyme G A A T T C A A T T C G C T T A A G G T T A A C One possible combination DNA ligaseseals the strands. Figure 20.3 Recombinant DNA molecule Using a restriction enzyme and DNA ligase to make recombinant DNA

  13. Cloning a Eukraryotic Gene in a Bacterial Plasmid • In gene cloning, the original plasmid is called a cloning vector • Defined as a DNA molecule that can carry foreign DNA into a cell and replicate there.

  14. Procedure for cloning a eukaryotic gene in a bacterial plasmid • Isolation of vector and gene-source DNA; we begin by preparing two kinds of DNA; • Bacterial plasmid to be used as a vector, form E. coli that carry two useful genes; • ampR (conferes resistance to ampicillin) • and lac Zthat encodes the enzyme β-galactosidase that hydrolysis the sugar lactose. • In addition this plasmid has a single recognition sequence that falls within the lac Z gene. • DNA containing the gene of interest let us say from humans.

  15. Insertion of DNA into the vector • Both DNA and the vector should be digested by the same restriction enzyme. • In this case the enzyme cuts the plasmid at its single cutting site thus disrupting the lacZ gene. • The enzyme also cuts the human DNA generating many thousands of fragments that have sticky ends. • One of these fragments carries the gene of interest • Fragments of human DNA are mixed with clipped plasmid vectors. The sticky ends of both types pair with each other • Use the DNA ligase to join the DNA molecules by covalent bonds

  16. Introduction of cloning vector into cells • In this step bacterial cells take up the recombinant plasmids by transformation. Now the bacteria that are lacZ- (negative) will be a mutation that are not able to hydrolyse lactose are most probably recombinant and have a foreign DNA.

  17. Most critical step in cloning; identifying clones that accepted foreign DNA • We plate out the transformed bacteria on sold nutrient agar medium containing ampicillin and a sugar called X-gal • Each reproducing bacteria forms a clone that a pears as a colony on the medium. • In this process most of the human genes will be cloned • The antibiotic makes us sure that only those bacteria have the ampR gene will grow while the X-gal makes us identify only the bacteria that contain the foreign DNA, how? • X-gal is hydrolysed by β-galactosidase to produce colonies with blue color • Colonies with blue color means that the lac Z gene was NOT disrupted, therefore, they did not include the foreign DNA, while the colonies appear whitish in color, means the lac Z is not working, i.e it was disrupted by the insert, therefore, this colony contains the human DNA insert. (Figure 20. 4)

  18. 1 2 3 Isolate plasmid DNA and human DNA. Cut both DNA samples with the same restriction enzyme Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Producing Clones of Cells Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. APPLICATION In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. TECHNIQUE lacZ gene (lactose breakdown) Bacterial cell Human cell Restriction site ampR gene (ampicillin resistance) Gene of interest Bacterial plasmid Stickyends Human DNAfragments Figure 20.4 Recombinant DNA plasmids

  19. 4 5 RESULTS Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinantbacteria Colony carrying non-recombinant plasmid with intact lacZ gene Colony carryingrecombinant plasmidwith disrupted lacZ gene Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Only a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Bacterialclone

  20. How can we identify the bacteria that contain the gene of interest • We can look either for the gene itself or we can look for the protein product of the gene • All methods of detecting the gene are based on the base pairing between the gene and other a complementary sequence on another nucleic acid molecule in a process called DNA • Hybridization using a nucleic acid probe (Figure 20.5).

  21. Identifying Clones Carrying a Gene of Interest • The probe is traced by labeling it with a radio label or a fluorescence tag following the procedure; • Bacterial colonies on agar are pressed against special filter thus transferring the colonies to the filter • Filter is treated to break open the cells and denature their DNA, with the resulting single stranded DNA molecules stick to the filter • A solution of probe molecules is incubated with the filter. The probe DNA hybridizes with any complementary DNA in the filter • The filter is laid on a photographic film allowing any radioactive areas to expose the film • The developed film an autoradiograph, is compared with the mastered culture plate to determine which colonies carry the gene of interest. • Once the clone carrying the gene of interest is identified, cells can be grown in liquid medium in a large tank to produce large amounts of the gene or its products such as a protein.

  22. 4 3 2 Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. APPLICATION TECHNIQUE RESULTS Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Colonies containinggene of interest Master plate Master plate ProbeDNA Solutioncontainingprobe Radioactivesingle-strandedDNA Gene ofinterest Film Single-strandedDNA from cell Filter Filter lifted andflipped over Hybridizationon filter The filter is treated to break open the cells and denature their DNA; the resulting single-stranded DNA molecules are treated so that they stick to the filter. A special filter paper ispressed against themaster plate,transferring cells to the bottom side of thefilter. After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. The filter is laid underphotographic film,allowing anyradioactive areas toexpose the film(autoradiography). 1 Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Figure 20.5 Nucleic acid probe hybridization

  23. Foreign genome cut up with restriction enzyme or Recombinantplasmids Bacterialclones Recombinantphage DNA Phageclones (a) Plasmid library (b) Phage library Figure 20.6 Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria • Is the collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genome

  24. The gene cloning procedure outlined in Figure 20-4 is called the shotgun approach as no single gene is targeted, instead thousands of different recombinant plasmids are actually produced and a clone of each ends up in a white colony. • The complete set of these clones is called genomic library, Figure 20-6a. Such library can be used later for exploring some other genes or for genome mapping.

  25. A genomic library made using bacteriophages • In addition to plasmids, certain bacteriophages are used as cloning vectors for using even larger genomic libraries. A genomic library made using phage is stored as collections of phage clones (Figure 20-6b).

  26. A complementary DNA (cDNA) library • Another type of genomic libraries is called cDNA library. • In this, researchers isolate mRNA from the cell that was transcribed from a number of genes. • Thus the cDNA library is made of a set of genes that were transcribed in the starting cells and the new DNA strand that is produced is called complementary DNA or cDNA. • This cDNA represents only part of the genome • This is advantageous for; • Studying the genes responsible for specialized functions of a particular type of cells such as brain or liver cells. • In addition by making cDNA library from cells of same type at different stages of life of an organism, researchers can trace changes in patterns of gene expression.

  27. Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library for a particular nucleotide sequence • The clones can sometimes be screened for a desired gene based on detection of its encoded protein, How? • Activity of the protein can be measured if for example it is an enzyme • Detection of the protein by antibodies. • Once the protein is identified, it can be produced in large amounts.

  28. Bacterial Expression Systems • Several technical difficulties • Hinder the expression of cloned eukaryotic genes in bacterial host cells • To overcome such problems • Scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter that leads to the expression of the eukaryotic protein. • The other problem is the presence of introns in the eukaryotic gene and the un-ability of the prokaryotes to process RNA so a cDNA of the gene which contains only the exons should be used in which the bacterial vector will be able to express.

  29. Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors • Helps avoid gene expression problems and the incompatibility of prokaryotic/eukaryotic system • Scientists has developed the YAC which combines the essentials of a eukaryotic chromosome, origin of replication, a centromere and two telomeres with foreign DNA. • YAC can carry a longer DNA segment than the bacterial plasmid thus the chance to clone the entire gene is much more than that in plasmids • Posttranslational modification is another advantage of using mammalian vector over the plasmid

  30. How to introduce DNA into cells? • There are different methods for this purpose • Electroporation; application of a brief electrical pulse applied to a solution contains cells will open membrane holes so that DNA can inter. • DNA can be injected directly into a single eukaryotic cell with the aid of microscope • In plants, the soil microbe, Agrobacterium can be used to infect the plant and introduce DNA

  31. Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR • Can produce many copies of a specific target segment of DNA and proves to be very useful when DNA is present in very few copies. • Items needed for this procedure; • The DNA to be amplified • Two short nucleotide primers that determines the DNA sequence that is amplified • Nucleotides ( dATP, dCTP, dGTP and dTTP) • Heat resistant DNA polymerase • PCR cycler

  32. Characteristics and uses of PCR • PCR is so specific to the point that starting material need not be purified • It is fast to the point that in about 3-4 hours you can do 40 cycles and of course amplifying your DNA millions of times • It can be used to amplify specific gene prior to cloning • Only minute amounts of DNA are needed to do the amplification It can be used for; • ancient DNA form 40,000 years old frozen woolly mammoth; • DNA from tiny amounts of blood, tissue or semen found at a crime scene. • DNA from single embryonic cells fro rapid prenatal diagnosis of genetic disorders and lots of other applications.

  33. 3 1 2 3 5 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. 3 5 Genomic DNA 3 5 Denaturation: Heat briefly to separate DNA strands 5 3 The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. TECHNIQUE Annealing: Cool to allow primers to hydrogen-bond. Cycle 1 yields 2 molecules Primers Extension: DNA polymerase adds nucleotidesto the 3 end of each primer Newnucleo-tides During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. RESULTS Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Figure 20.7 The PCR procedure

  34. Concept 20.2: Restriction fragment analysis • detects DNA differences that affect restriction sites • Can rapidly provide useful comparative information about DNA sequences

  35. 1 2 APPLICATION TECHNIQUE RESULTS Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Mixture of DNA molecules of differ- ent sizes Cathode When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. Gel Power source Glassplates Anode Longermolecules Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. Shortermolecules After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Figure 20.8 Gel Electrophoresis and Southern Blotting • Gel electrophoresis separates DNA restriction fragments of different lengths

  36. DdeI DdeI DdeI DdeI Normal  -globin allele 201 bp Large fragment 175 bp Sickle-cell mutant -globin allele Large fragment 376 bp DdeI DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene. Sickle-cellallele Normalallele Largefragment 376 bp 201 bp175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Figure 20.9a, b Restriction fragment analysis • Is useful for comparing two different DNA molecules, such as two alleles for a gene

  37. Southern blotting an overview • Identifies Specific DNA fragments in the genome. • the gel will be overlaid with a nylon or nitrocellulose membrane and several layers of filter papers. • The setting will be submerged with an alkaline solution that will pull the bands out of the gel and transfer them to the membrane meanwhile denaturing the DNA by the action of the alkaline solution • After certain time, the filter papers pulled out and the bands are exposed to a solution containing radioactive probe which is single stranded DNA that is complementary to the gene of interest

  38. Rinse a way unattached probe and expose membrane to an X-ray film. In this case the radioactive probe that hybridized with the gene of interest will expose the film to form an image corresponding to DNA bands that hybridized to the probe. • From looking at the band pattern, it appears that band patters of sample I and II and III are different from each other as shown in Figure 20.10. • This process is called southern blotting after E. M Southern who developed the method in 1975.

  39. APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). Heavyweight Nitrocellulose paper (blot) Restriction fragments DNA + restriction enzyme I II III Gel Sponge Papertowels I Normal -globin allele Alkalinesolution II Sickle-cell allele III Heterozygote Blotting. 3 Gel electrophoresis. Preparation of restriction fragments. 2 1 Figure 20.10 Southern blotting of DNA fragments

  40. RESULTS Probe hydrogen- bonds to fragments containing normal or mutant -globin I II III I II III Radioactively labeled probe for -globin gene is added to solution in a plastic bag Fragment from sickle-cell -globin allele Film over paper blot Fragment from normal -globin allele Paper blot 1 2 Hybridization with radioactive probe. Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II).

  41. Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) • Are differences in DNA sequences in non-coding sequences on homologous chromosomes that result in restriction fragments of different lengths • They are scattered abundantly through out genome and serve as a genetic markers for particular locations (locus) in the genome.

  42. RFLPs • Can be detected and analyzed by Southern blotting (Figure 20.10). • The thousands of RFLPs present throughout eukaryotic DNA • Can serve as genetic markers i.e a measure of closeness of two loci in a chromosome. • Because they are inherited in a mendelian fashion, they can serve as genetic markers for making linkage maps

  43. GENOME MAPPING • Concept 20.3: Entire genomes can be mapped at the DNA level • The Human Genome Project • Sequenced the human genome from 1990-2003 • Scientists have also sequenced genomes of other organisms • Providing important insights of general biological significance

  44. Genetic (Linkage) Mapping: Relative Ordering of Markers • The initial stage in mapping a large genome • Is to construct a linkage map of several thousand genetic markers spaced throughout each of the chromosomes • The order of the markers and the relative distances between them on such a map are based on recombination frequencies • These markers can be genes or RFLPs or short repetitive sequences (microsatellites). Based on these, researchers finished the human genetic map with 5000 markers.

  45. Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Chromosome bands Genetic markers Genes located by FISH Genetic (linkage) mappingOrdering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) 1 Physical mapping Ordering of large over- lapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors 2 Overlappingfragments 3 DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the com- plete genome sequence 3 …GACTTCATCGGTATCGAACT… Figure 20.11 Three stage approach to mapping the entire genome

  46. Physical Mapping: Ordering DNA Fragments • A physical map gives the actual distance in base pairs between markers • Is constructed by cutting a DNA molecule into many short fragments and then determine the original order of the fragments in the DNA • The key is to make fragments that overlap and then use probes to identify the overlaps • Researchers carry out several rounds of DNA cutting, cloning and physical mapping • Supplies of DNA fragments used for physical mapping are prepared by cloning. • First cloning vector is often YAC or BAC for long DNA pieces and then smaller plasmids are used for ordering shorter DNA pieces.

  47. DNA Sequencing • Relatively short DNA fragments can be sequenced by the dideoxy chain-termination method as following; • Incubate DNA template strand (single) with DNA polymerase, 4 dioxynucleotides and the 4 flouresent labelled didioxyribonucleotides • Synthesis of the new strands starts at the 3’ end and continues until a ddN is incorporated instead of the regular dioxyribonucleotide which prevents further elongation. • Eventually a set of labeled strands of various length is produced with the color of the tag representing the last nucleotide in sequence. • Labeled strands are separated by capillary electrophoresis with shorter strands moving faster. • The color of the tag will be detected by a fluorescence detector.

  48. APPLICATION RESULTS TECHNIQUE The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Dideoxy chain-termination method for sequencing DNA DNA (template strand) Primer Dideoxyribonucleotides (fluorescently tagged) 3 Deoxyribonucleotides T G T T 5 The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. dATP ddATP C T G A C T T C G A C A A 5 dCTP ddCTP DNA polymerase dTTP ddTTP dGTP ddGTP P P P P P P G G OH H 3 This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide. In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. Labeled strands DNA (templatestrand) 3 5 ddG A C T G A A G C T G T T C T G A C T T C G A C A A ddA C T G A A G C T G T T ddC T G A A G C T G T T ddT G A A G C T G T T ddG A A G C T G T T ddA A G C T G T T ddA G C T G T T ddG C T G T T ddC T G T T 3 Direction of movement of strands Laser Detector G A C T G A A G C Figure 20.12

  49. Linkage mapping, physical mapping, and DNA sequencing • Represent the overarching (umbrella) strategy of the Human Genome Project • An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments (approach of Craig Venter from Celera Genomics) • Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence (Figure 20-13).

  50. Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing. 1 2 3 4 Clone the fragments in plasmid or phage vectors Sequence each fragment ACGATACTGGT CGCCATCAGT ACGATACTGGT Order the sequences into one overall sequence with computer software. AGTCCGCTATACGA Figure 20.13 …ATCGCCATCAGTCCGCTATACGATACTGGTCAA…

More Related