Chapter 11: The Control of Gene Expression

1. Chapter 11: The Control of Gene Expression Life 1402: Principles of Biology

2. 23 23 46 23 1. Cellular Differentiation during embryonic development a. a zygote is the first cell of an organism with a full compliment of DNA

3. 1. Cellular Differentiation during embryonic development b. the zygote undergoes mitosisgiving rise to genetically identical daughter cells

4. 2. Cellular Differentiation during embryonic development c. with each mitotic division during development, the daughter cells inherit identical copies of DNA; therefore, every diploid cell in an organism is genetically identical unless mutations occur

5. 2. Cellular Differentiation during embryonic development d. cellular differentiationis the process by which genes are turned on and off, not changed, during embryonic development

6. 2. Cellular Differentiation during embryonic development e. cellular differentiation results in different tissue types in a single organism

8. Turning Genes On and Off • http://www.youtube.com/watch?v=dSiSHRwR49k • http://www.youtube.com/watch?v=CkR53X8vksY

9. 3. The lac operon a. Collection of genesthat regulate protein synthesis depending upon the cell’s needs b. Described as found in E.coli

10. 3. The lac operon c. Operon is turned off in the absence of lactose d. Operon is turned on in the presence of lactose

11. 4. Cloning

12. 4. Cloning a. A clone is a cell or organism that is genetically identical; e.g., identical twins which result from separation of an embryo before differentiation occurs b. Variable success has been realized in attempts to clone organisms, even mammals c. Both ethical and physical barriers exist when cloning of humans is considered

13. 4. Cloning d. Basic process of cloning 1. nucleus is removed from an egg 2. nucleus is removed from an adult somatic cell and injected into the egg which had its nucleus removed 3. the resulting cell is then grown in culture to produce a blastocyst; i.e., an early embryo consisting of a ball of app. 200 cells 4. the blastocyst can then be used to produce an entire organism (reproductive cloning) or used to provide embryonic stem cells which can be grown in culture (therapeutic use)

15. Egg Cell Egg Cell

16. Egg Cell

17. Egg Cell

19. 5. Nuclear transplantation a. the process of cloning described above results from nuclear transplantation; i.e., a nucleus from a differentiated adult cell is transplanted into a non-differentiated egg cell b. nuclear transplantation experiments have resulted in clones of plants and animals

20. 5. Nuclear transplantation c. the resulting clones are genetically identical to the donor parent regardless of the adult cell type used as a donor d. differentiated adult cells must all have the same DNA if clones result from nuclear transplantation regardless of the donor cell type

21. 5. Nuclear transplantation e. if the genome were different among different adult cell types, clones from these different cells would not be the same

22. 6. Application of reproductive cloning a. Dolly is a sheepthat was cloned from an adult cell b. Since Dolly, reproductive cloning has been used to establish clones for scientific, medical, and agricultural uses

23. 6. Application of reproductive cloning c. Scientists have cloned pigs with a gene "knocked out" that codes for a protein making their hearts activate our immune system --- What's the application?

24. 6. Application of reproductive cloning d. Scientists have cloned farm animals with specific sets of desirable traits e. Scientists are cloning mammals that are genetically engineered to synthesis valuable drugs

25. Got Clones?

27. 7. Stem cells a. stem cells are cells that have not yet differentiated b. in the appropriate conditions, stem cells can be stimulated to differentiate into specific cell types; e.g., nerve cells, muscles cells, etc. thus providing a source of tissue for therapeutic use

29. Stem Cells http://video.pbs.org/video/1506726820/ http://video.pbs.org/video/1511335379/

30. 7. Stem cells c. growth factors can turn on and turn off particular genes and thus determine the fate of a particular cell d. embryonic stem cells are taken from early embryos and have thepotentialto differentiate into any cell type

31. 7. Stem cells e. adults have stem cells; e.g., bone marrow cells differentiate into different blood cell types and epidermal germ cells differentiate into different skin cell types f. although adult stem cells are typically more difficult to work with, they provide a potential source of stem cells without destroying embryos

32. 8. Cancer a. cancer can be caused by mutations in genes that control cell growth b. genes that cause cancer are called oncogenes, these are usually mutated genes that produce growth factor to stimulate cell division

33. 8. Cancer c. genes that may become cancer causing are proto-oncogenes d. tumor suppressor genes inhibit cell growth, mutations of these genes can also cause cancer

34. 8. Cancer e. carcinogen – “cancer generator” factors in the environment that can cause cancer

35. CHAPTER 12DNA Technology and the Human Genome

36. 1.      Cloning of genes through genetic engineering • a.genetic engineering = direct manipulation of genes for practical purposes • b.gene cloning = making identical copies of genes (fig 12.1)

37. 1.      Cloning of genes through genetic engineering • c.recombinant DNA = joining of two different sequences of DNA • d.plasmid = small, circular DNA molecule separate from the larger bacterial DNA

38. 1.      Cloning of genes through genetic engineering • e.vector = virus or cell that transfers DNA to another cell

39. 2.  Restriction enzymes (fig 12.2) • a.enzyme = a substance, usually a protein, that catalyzes (facilitates) a reaction • b.restriction enzyme = an enzyme that recognizes a specific sequence of DNA and digests (cuts) the DNA at that recognition site

40. AATTC G GAATTC AATTC G GAATTC 2.  Restriction enzymes • c.the resultant pieces of DNA after digestion with a restriction fragment are termed restriction fragments (if a linear strand of DNA has two recognition sites, digestion will produce three restriction fragments)

41. 2.   Restriction enzymes • d.the cut ends of DNA are “sticky”; i.e., they will join together (anneal) with other “sticky” ends cut with the samerestriction enzyme ATCGATCGATGCTAGCACA ATCGAATCGATGCTAGCACA TGATCGTATCGATGCTAGCACATT TGAGCTAGCATCGATCGATAA TGAGCTAGCATCGATTCGATAA TGAGCTAGCATCGAATCGATCA ATCGTT CGATCA CGATGCTAGCACATT TGAGCTAGCATCGAA

42. 2.   Restriction enzymes • d.the cut ends of DNA are “sticky”; i.e., they will join together (anneal) with other “sticky” ends cut with the samerestriction enzyme ATCGAATCGATGCTAGCACA TGATCGAATCGATGCTAGCACATT TGAGCTAGCATCGATTCGATAA TGAGCTAGCATCGATTCGATCA TCGATGCTAGCACATT TGAGCTAGCATCGAAA

45. 2.   Restriction enzymes • e.this is how the human insulin gene is removed from human DNA and spliced into the bacterial DNA

46. 2.   Restriction enzymes • f. restriction enzymes are also used in forensic science to establish a DNA fingerprint = a set of restriction fragments unique to an individual

47. 2.   Restriction enzymes (fig 12.2) • g.Overview of the technology behind gene cloning using bacterial plasmids (fig 12.3) Bacterium Bacterialchromosome Plasmid

48. Cell containing geneof interest 1 Bacterium Plasmidisolated 2 DNA isolated 3 Gene inserted into plasmid Bacterialchromosome Plasmid Gene ofinterest Recombinant DNA(plasmid) DNA 4 • 1.gene of interest; e.g., human insulin gene, is removed from host DNA and inserted into bacterial plasmid DNA thus making recombinant DNA • Figure 12.3

49. Cell containing geneof interest 1 Bacterium Plasmidisolated 2 DNA isolated 3 Gene inserted into plasmid Bacterialchromosome Plasmid Gene ofinterest Recombinant DNA(plasmid) DNA 4 Plasmid put intobacterial cell Recombinantbacterium • 2.recombinant plasmid reinserted into bacterium thus producing a recombinant bacterium • Figure 12.3

50. Cell containing geneof interest 1 Bacterium Plasmidisolated 2 DNA isolated 3 Gene inserted into plasmid Bacterialchromosome Plasmid Gene ofinterest Recombinant DNA(plasmid) DNA 4 Plasmid put intobacterial cell Recombinantbacterium 5 Cell multiplies withgene of interest Clones of cell • 3.as recombinant bacterium reproduces, gene of interest is cloned; i.e., the bacterium replicates the gene of interest along with its own DNA prior to each mitotic division