microbial genetics from genotype to phenotype l.
Download
Skip this Video
Download Presentation
Microbial Genetics: From Genotype to Phenotype

Loading in 2 Seconds...

play fullscreen
1 / 34

Microbial Genetics: From Genotype to Phenotype - PowerPoint PPT Presentation


  • 227 Views
  • Uploaded on

Microbial Genetics: From Genotype to Phenotype. Nucleic acid synthesis Protein Synthesis Heredity Genetic Recombination Microevolution. Microbial Genetics. Review Nitrogenous base dNTP Base pairing DNA RNA Coding strand Template strand.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Microbial Genetics: From Genotype to Phenotype' - adriel


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
microbial genetics from genotype to phenotype

Microbial Genetics:From Genotype to Phenotype

Nucleic acid synthesis

Protein Synthesis

Heredity

Genetic Recombination

Microevolution

microbial genetics
Microbial Genetics

Review

Nitrogenous base

dNTP

Base pairing

DNA

RNA

Coding strand

Template strand

Notable differences in hereditary material in viruses, prokaryotes and eukaryotes

Important basis for modern methods of identification and disease diagnosis

what does dna do
What does DNA do?

Bacterial cell

DNA

transcription

DNA replication: Cell Division requires duplication of DNA

RNA

translation

Clones

protein

Large molecules of DNA are called chromosomes

Bacteria have circular chromosomes and sometimes additional small, circular pieces of DNA called plasmids

replication of dna
Replication of DNA
  • Because DNA is double stranded replication can occur on each strand simultaneously in opposite directions
  • Continuous, newly synthesized strand added in 5’ to 3’ is leading strand
  • DNA synthesized from behind by the addition of Okazaki fragments is lagging strand, olignucleotides are still added to the 3’ end
dna replication
DNA replication

Original double stranded DNA

Two new strands (green dotted lines) are created using a polymerase enzyme

The process of creating the new strands is called polymerization

dna polymerization
DNA polymerization

Sugar phosphate backbone

Nitrogenous bases

3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…………….5’

5’ATCGAACGGAGACTTACTCTTA3’

T

DNA Polymerase

A

A

G

A

T

C

C

A

G

T

A

dNTPs are are added to the new strand (green) so that the dNTPs pair with the corresponding ones on the complimentary strand (black)

dna polymerization7
DNA Polymerization
  • Polymerization, requires DNA polymerase enzyme
  • Synthesis occurs only from 5’ to 3’ of new strand
  • dNTP incorporated into 3’ end of new strand by DNA polymerase
  • Formula for polymerization:

(dNMP)nDNA +dNTP(dNMP)n+1DNA + PPi

  • (dNMP)nDNA is the growing strand
  • dNTP is the deoxynucleotide triphosphate
  • (dNMP)n+1DNA is the growing strand after a dNTP is added
  • iPP is inorganic diphosphate
slide8

Original strands are separated generating replication forks

5’

3’

Synthesis occurs on both strands of original DNA in opposite directions

Okazaki fragments

Leading strand

Lagging strands

Leading strand

nucleic acid polymerization
Nucleic acid polymerization

5’

Nitrogenous base

Nitrogenous base

Nitrogenous base

Nitrogenous base

Nitrogenous base

Nitrogenous base

Polymerase enzyme

Nucleotide triphosphate

Nitrogenous base

Inorganic phosphate

transcription is synthesis of rna from dna
Transcription is synthesis of RNA from DNA
  • NTPs (ATP, CTP, GTP, UTP) incorporated in to strand of mRNA (RNA polymerization)
  • mRNA is complementary to the template strand of DNA
  • RNA polymerase enzyme is used
what is a gene
What is a gene?

tRNA

rRNA

DNA

mRNA

protein

synthesis of mrna
Synthesis of mRNA

Double stranded DNA has a coding strand (+) and template strand (-)

5’

3’

+

Original strands are separated where transcription is to begin

mRNA synthesis occurs on the template strand (-) of original DNA

synthesis of mrna13
Synthesis of mRNA

Template strand of DNA

3’TACCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…………….5’

5’AUGGAACGGAGACUUACUCUUA3’

U

RNA Polymerase

A

A

G

A

U

C

C

A

G

U

AUG is start codon

A

genetic code for building proteins
Genetic Code for Building Proteins

Every three bases (triplet) of DNA corresponds to a codon of mRNA which corresponds to an anticodon in tRNA which bares a specific amino acid

Use the table in your book to provide the amino acids for the following DNA sequence on the coding strand :

CGTCCCGTC

eukaryotes
Eukaryotes

DNA contains introns and exons

I

I

I

I

I

I

I

Exons have the code to build proteins

slide16

Components of Prokaryote Ribosome

21 different proteins

16SrRNA

30S subunit

31 different proteins

70S ribosome (prokaryotes)

23S rRNA and 5S rRNA

50S subunit

ribosomes
Ribosomes

The site of protein synthesis

Prokaryotes have 70S ribosomes

Eukaryotes have 80S ribosomes

Because ribosomes do such an important job drugs that inhibit them have drastic effects on the cell (many antibiotics and the toxin ricin inhibit protein synthesis by binding to ribosomes)

The genes for ribosomal RNA are often used to measure the similarity between organisms

16SrRNA gene for bacterial systematics

18SrRNA gene for eukaryote systematics

translation
Translation

Growing polypeptide connected by enzymatic linkage between amino acids

tRNA

mRNA

ribosome

example of regulation of protein synthesis enzyme induction
Example of regulation of protein synthesis: Enzyme Induction

Prom. Oper. Gene

Pol.

Substrate binds to repressor allowing polymerase to transcribe mRNA

repressor

mRNA

substrate

Enzyme synthesized

Enzyme acts on substrate

example of regulation of protein synthesis enzyme induction20
Example of regulation of protein synthesis: Enzyme Induction

Prom. Oper. Gene

Pol.

repressor

Gene turned ‘off’

In the absence of substrate, the repressor blocks polymerase enzyme

Note: the status of a gene being turned on or off is not heritable. While it allows individual organisms to adapt to changing circumstances, it does not effect the evolution of species as does mutation.

mutation
Mutation
  • Point mutation -results from the replacement of a nitrogenous base effects may 1. be “silent” causing no change in the protein structure, or 2. result in altered protein with different performance or 3. produce protein that doesn’t work
  • Frameshift mutation -results from the insertion or deletion of bases, has dramatic effects on protein, often deleterious.
slide22

The genetic code is analogous to written language

Suppose the sentence below is a genetic sequence:

the red fox ran out

After a point mutation the sentence might be:

the red fax ran out

After a frame shift mutation (deletion of letter e) the sentence might be:

thr edf oxr ano ut

mutagens
Mutagens
  • Chemicals that bind to DNA and affect the process of replication or transcription. Some naturally occurring chemicals are mutagenic, many industrial chemicals are mutagenic
  • Radiation, including UV light, is mutagenic
genetic variation results from mutation
Genetic Variation Results from Mutation

Most mutations are either harmful, or neutral, but sometimes they are beneficial.

If the mutations are not too harmful, they will be passed on to their progeny (offspring). This is the hereditary basis of evolution.

These heritable changes in a lineage or populations of organisms over generations contribute to micro-evolution

antibiotic resistance in bacteria
Antibiotic Resistance in Bacteria
  • Bacteria can multiply rapidly into large populations that reach a stationary phase
  • Antibiotic therapy or accidental ingestion of antibiotics acts as an agent for natural selection
  • Single point mutation in DNA can lead to resistance in a single mutant bacterium
  • Mutant ‘lost in crowd’ until antibiotic therapy kills off susceptible bacteria
  • Mutant becomes dominant in population and gives rise to mutant clones
variation by mutation is compounded by genetic recombination
Variation by Mutation is Compounded by Genetic Recombination
  • Sexual reproduction
  • Bacterial transformation
  • Bacterial conjugation
  • Virus-mediated gene transfer
  • Other transfer between symbionts
sexual reproduction is genetic recombination
Sexual reproduction is genetic recombination

parent cells produced gametes by meiosis

Gametes fuse to form a zygote

zygote

gametes

slide28

2N diploid stage

gametogenesis

fusion of gametes

1N haploid stage

sperm

egg

slide29

Bacterial Transformation

Heat-killed bacterium disintegrate and release DNA into surroundings

Bacterium with gene for capsule

Bacterium without gene for capsule

Genes taken in and expressed

conjugation
Conjugation
  • Plasmids may contain genes that allow a bridge (pilus) to form between two bacteria. Bacteria with these plasmids are F+
  • The plasmid from the F+ (donor) bacterium is replicated and transferred to the F- (recipient) bacterium

pilus

F+

F-

F+

F-

1.

2.

high frequency recombinations
High frequency recombinations

Plasmid inserts into chromosome

chromosome

F+

recipient

Hfr+

Hfr+ DNA transferred into recipient and inserted into chromosome

Hfr+

recipient

transposable elements jumping genes
Transposable elements (jumping genes)
  • A mobile genetic sequence that can move from one plasmid sequence to another sequence or to a chromosome
  • May result in the disruption of gene activity
  • Make up a large portion of Eukaryote DNA
transduction
Transduction
  • Some viruses can incorporate their genetic material into the host’s chromosome
  • When the virus is transferred from host to host, some of the host’s genes can be transferred along with the virus’s genes into the next host.
slide34

Transduction

Bacterium with its chromosome containing viral (Prophage) DNA

Prophage DNA excised from host chromosome

Phage infects new bacterium bringing with it DNA from the previous one

Phage DNA inserts into new host chromosome along with bacterial genes