1 / 28

Test Results and Study Tactics for Biochemistry Students

Explore detailed test results and study tactics for biochemistry students. Learn about approximate pace, numerical breakdown, study tactics, test tactics, and RNA processing insights. Adjust your strategies and excel in your biochemistry course.

abussell
Download Presentation

Test Results and Study Tactics for Biochemistry Students

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Test Results • Overall Average : 48 ±14 (6-81) • Multiple Choice Average: 25±6 (6-38) • Fill in Average:10±4 (0-20) • Short Answer/Diagram Average:13±7 (0-35) • Question 2 is misgraded, I will adjust for it later.

  2. Approximate Pace • 48 is middle C • 48+14 (1StD) = 62 is middle B • 48+28 (2StD) = 76 is middle A • 48-14 (1StD) = 34 is middle D • 48-28 (2StD) = 20 is middle F

  3. Numerical Breakdown • 11 in A range • 25 in B range • 56 in C range • 26 in D range • 9 in F range

  4. Study Tactics • Read Chapter and Study Figures • Study Summary, Key Terms; Questions • Flashcards • Reread chapter carefully in quiet place while taking notes • Create your own outline of chapter • Practice diagrams on paper; the text discusses each step • Quiz study partner • Discuss subjects with friends • Grill your T.A. at recitation about the subject matter

  5. Test Tactics • Assess your strengths/weaknesses • Survey test and determine pace • Fill in high points questions if you know the answers • Rapidly go through MC and fill ins and answer the ones you know • Use remaining time to use the process of elimination to better statistical chances on the remaining multiple choice • Revisit high point questions and try to garner some partial credit • Do not dilute correct pieces with too much random guessing

  6. Syllabus Change • We will only go to Chapter 8 by the end of next week. • Read Chapter 8 by Wednesday

  7. RNA Processing • Prokaryotes • rRNAs • tRNAs • Eukaryotes • rRNAs • tRNAs • mRNAs

  8. Specialized Processing SystemsrRNA Methylation Glycosylation 5S

  9. Specialized Processing Systemspre-tRNAs to tRNA

  10. Eukaryotic mRNA ProcessingOverview

  11. Eukaryotic mRNA ProcessingPolyadenylation

  12. Eukaryotic mRNA ProcessingSplicing: Methods

  13. Eukaryotic mRNA ProcessingSplicing: Two Step Reaction YYYYYYYYYN(C/U)AG|G(G/U) (A/C)AG|GU(A/G)AGU

  14. Eukaryotic mRNA ProcessingSplicing: Spliceosome • snRNAs • 50-200 nt • U1,U2,U5,U6, • snRNPs • snRNA +6-10 proteins

  15. Eukaryotic mRNA ProcessingSplicing: Alternative Splicing

  16. RNA Degradation • Half life of mRNAs • rRNAs and tRNAs: very long • mRNAs • Bacteria : approx. 2-3 minutes • Mammals: < 30 min to >20 hours Transferrin (Fig.6.48)

  17. Proteins • Synthesis: Translation of mRNA • Folding and Processing • Regulation of Function • Degradation

  18. Protein SynthesisTranslation of mRNA

  19. Protein SynthesisPolycistronic vs. Monocistronic

  20. Protein SynthesisThe Genetic Code

  21. Protein SynthesisDecoding Example AUGUUCGACUGCAACCCCCCGUAA AUGUUCGACUGCAACCCCCCGUAA Met Phe Asp Cys Asn Pro ProStop

  22. Protein SynthesisTransfer RNAs • tRNAs • 70-80 nt • Cloverleaf • Anticodon loop • amino acid attachment site

  23. Protein SynthesisAminoacyl tRNA Synthetases • Approx. 40 • Why not 64? • Why not 61? • Wobble • I can pair with C, U, orA

  24. Protein SynthesisRibosomes

  25. Protein SynthesisSignals for Initiation

More Related