Patman
Uploaded by
36 SLIDES
735 VIEWS
360LIKES

Stability and Compensated Pathogenic Deviations

DESCRIPTION

Stability and Compensated Pathogenic Deviations. Fyodor A. Kondrashov Section of Ecology, Animal Behavior and Evolution University of California at San Diego. How can we make an elephant from scratch?. giraffe. elephant. TACG. ATGC. AT CG. Common ancestor. giraffe. ATGC. ATG G.

1 / 36

Download Presentation

Stability and Compensated Pathogenic Deviations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Stability and Compensated Pathogenic Deviations Fyodor A. Kondrashov Section of Ecology, Animal Behavior and Evolution University of California at San Diego

  2. How can we make an elephant from scratch?

  3. giraffe elephant TACG ATGC ATCG Common ancestor

  4. giraffe ATGC ATGG ATCC TTGC AAGC AAGG ATCG TTGG TAGC TTCC AACC TTCG TAGG TACC AACG Common ancestor elephant TACG

  5. Ideal World Breeding Real World Breeding x x

  6. Fitness Genotype Genotype

  7. MITOMAPA human mitochondrial genome database A compendium of polymorphisms and mutations of the human mitochondrial DNA Are human pathogenic mutations also pathogenic to closely related species?

  8. Methods. Genbank 22 tRNA multiple alignments with 106 mammals and with marked CPDs ENTREZ Phylogeny information Complete mammalian mitochondrial genomes FEDYA, ANDY, TEXTPAD, mfold EYES and PERL Pathogenic mutations Synteny preserved in most mammals (except marsupials) CLUSTAWL Multiple alignment Secondary structure info

  9. A multiple alignment of primate orthologs for Glycine (G) tRNA. human actcttttagtataaat--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta chimpanzee actcttttagtataaGt--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta pygmy chimpanzee actcttttagtataaGc--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta gorilla actcttttagtataatt--agtaccgttaacttccaattaaccagttttggt-agtacccaaaaaagagta orangutan actcttttagtataaGc--agtaccgttaacttccaattaaccagttttgac-aacactcaaaaaagagta Sumatran orangutan actcttttagtataaac--agtaccgttaacttccaattaactagttttgac-aacGcccaaaaaagagta hamadryas baboon actcttttagtataatt--agtacaAttgacttccaatcaatcagctttgac-aatattcaaaaaagagta Barbary ape actcttttagtataacc--agtacaAttgacttccaatcaatcagttttgac-aacattcaaaaaagagta common gibbon actcttttagtataaac--agtactgttaacttccaattaaccagcttcgat-aacGctcgaaaaagagta capuchin attctcttagtataaac--agtacaAttgacttccaattaataggccttgat-aa-acccaagagagaata ring-tailed lemur attcttttagtatcgacccaatacaAttgacttccaattaattaacttcggtgaa-aaccggaaaagaata slow loris gctcttttagtacaact--agtacaAttgacttccaatcaataggatttggtaaataaccaaaagagagca western tarsier gttcctttagtatcaatt-agtacaAttgacttccaatcaattagccctagtacaattctaggaaggaaca . * . * *

  10. A multiple alignment of selected mammalian orthologs for Luicine UUR (L1). human gttaagatggcagagcccggtaatcgcataaaacttaaaactttacagt-cagaggttcaattcctcttcttaaca western tarsier gttaagatggcagagcccggCaattgcataaaacttaaaactttattat-cagaggttcaactcctcttcttaaca northern tree shrew gttaaggtggcagagcccggtcattgcctaaaacttaagattttaAgta-cagaagttcaaatcctctccttaaca European hare gttaaggtggcagagcccggCaattgcataaaacttaaaactttataat-cagaggttcaactcctctccttaaca Egyptian jerboa gctaagatggcagagcccggtaattgcaCaagacttaaaccCttgAatc-cagaggttcaactcctcttcttaGca Eurasian red squirrel attaagatggcagagcccggcaattgcataagatttaaaacCttactat-cagaggttcaactcctcttcttaaTa Madagascar hedgehog attaagatggcagagcc-ggtaattgcaCaagacttaaaccCttgctgt-cagaggttcaatCcctcttcttaaTa little red flying fox gttaggatggcagagcccggCaattgcataaaacttaagcttttataat-cagaggttcaactcctcttcctaaca Japanese house bat gttaaagtggcagagaccggtaattgcataaaacttaagattttagagc-cagaggttcaactcctctctttaaTa polar bear gttagggtggcagagcccggtGattgcataaaacttaaacctttatact-cagaggttcaaatcctctccctaaca Atlantic walrus gttagggtg-cagagcccggtaattgcataaaacttaaacttttacccc-cagaggttcaactcctctccctaaTa greater Indian rhino gttaggatggcagagcccggtaactgcataaaacttaaacctttataac-cagaggttcaactcctcttcctaaca narwhal gttgggatggcagagtacggCaattgcataaaacttaaacctttatacc-cagaggttcaaatcctcttcccaaca Indus River dolphin gttgaggtggcagagtccggCaattgTataaaacttaaacttttacact-cagaggttcaaatcctctccccaaca pig attagggtggcagagaccggtaattgcgtaaaacttaaacctttattac-cagaggttcaactcctctccctaaTa nine-banded armadillo gttaagatggcagagacaggtaattgcataagacttaaacctttattac-cagaggttcaaatcctcttcttaaca aardvark gttaaggtggcagagcccggtaattgcataaaacttaagcttttacaac-cagaggttcaattcctctccttaaca Asiatic elephant gttaagatagcaaaaattggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca African elephant gttaagatagcaaaaactggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca wallaroo attaaggtggcagagcc-ggCaattgcataaaacttaaacctttataat-cagaggttcaaatcctctccttaaTa common wombat attaaggtggcagagca-ggtaattgcataaaacttaagcctttacaac-cagaggttcaaaCcctctccttaaTa platypus attaaggtgacagagaccggtaattgTgtaaaacttaagcttttatagt-cagaggttcaaatcctctccttaaTa Australian echidna attaaggtgacagagaccggCaattgTgtaaaacttaagcttttataat-cagaggttcaaatcctctccttaaTa . .**. . * * . . * . * * . * **

  11. Compensated Pathogenic Deviation (CPD) Molecular event (substitution or other) that is present in a wild-type in one species and is pathogenic in another species. Compensatory Deviation Molecular event (substitution or other) that negates the deleterious effect of a Pathogenic Mutation

  12. Homo sapiens tRNAAsn 3’ G 5’ U A A U Acceptorstem G C A U U G U G G G U U A U A C C C A A U G A U G U G G G U A C C G G U U U A U G G G U U TYC-stem/loop A U U G G U D-stem/loop C G U A U A Anticodonstem/loop A U G C C A U A G U U Can we say anything about a molecular or structural basis of compensations?

  13. Pan troglodytes(chimpanzee) tRNAAsn 3’ G 5’ U A A U Acceptorstem G C A U G U A U A G G G U U A U A C C C A A U G A U G U G G G U A C C G G U U U A U G G G U U TYC-stem/loop A U U G G U D-stem/loop U A C U A G U A A U Anticodonstem/loop G C C A U A G U U Figure 2a

  14. Cynocephalus variegatus (Malayan flying lemur) tRNALys 3’ A Acceptorstem 5’ C G A U G C U A C A U G C U A U U CA C G C A D-stem/loop A C C C U U C A A C A U U G G A A G G U C G A C U A U C A A C G A G A C A A U A A TYC-stem/loop U U G A U A U A A U Anticodonstem/loop A U C G C A U A U U U Figure 2b

  15. human CG Common ancestor CA UG UA chimp

  16. Ceratotherium simum (white rhinoceros) tRNATrp 3’ G 5’ A U Acceptorstem G C G C U A A U A U U A TYC-stem/loop U A A C A U U U C A U A A A C U U G G A A G U A A A C C U C G A C C U C A C G G UA A A D-stem/loop A A U C G C A G C Anticodonstem/loop G A C C G C A U A U A C Figure 2c

  17. Ursus maritimus(polar bear) tRNASer(UCN) 3’ A 5’ G U A U A U G C A U Acceptorstem A G U U A U G C C U A U G A C U U C C A G G U A U A G A G G G C C G G U U A U U A U G G G C U TYC-stem/loop U A C C U G C U A U G D-stem/loop C G U A G U A Anticodonstem/loop G C G C C A U A U A G Figure 2d

  18. Spalax ehrenbergi(Ehrenberg's mole-rat) tRNAIle 3’ A 5’ A U G C Acceptorstem A U A U TYC-stem/loop A U A C G U A U A C G U U C U C C A U G A A G A G G A G C C U C U U U A A A G C A G A A UU C A G A U A U A D-stem/loop A U G A U Anticodonstem/loop C G U A U G U A G U A Figure 2e

  19. Tamandua tetradactyla (southern tamandua) tRNAIle 3’ A 5’ A U G C A U Acceptorstem A U TYC-stem/loop A U U A C A A U G C U A U C U C C U U C G A A G A G G A G C C U C U C A U A A A G A G G A U A U C C A D-stem/loop U A A A A U U G U A A U Anticodonstem/loop C G U A U G U A G U A

  20. Hyperoodon ampullatus (northern bottlenose whale) tRNALeu(UUR) 3’ A 5’ G C Acceptorstem U A U A U G C A G U A U G C D-stem/loop G C A C U A U U A U C U C C C G U A C G A G A C G A G A G G U C U U C G C U G U C TYC-stem/loop U G A C A C G A C C U A U C U A A U Anticodonstem/loop A U A U C A U C A C U A A U A Figure 2f

  21. Tachyglossus aculeatus (Australian echidna) tRNALeu(UUR) 3’ A 5’ A U C G U A U A Acceptorstem A U A U U G C D-stem/loop A G C U C A U G A U C U C C U G A A A C G A G A G G C G A C A C U U C G TYC-stem/loop U U U G U G A A C A G A C C G U U U A A A U C A U Anticodonstem/loop A U C A U C C A U G A U A A

  22. Oryctolagus cuniculus (rabbit) tRNACys 3’ U 5’ A U G C C G U C G C G A C C U G G C A C A A C G U C U A G G U C G C A G C G G U G A U U A C A C A U U A A A G A U U A U G U A G C A U A U U A U A G A C

  23. Canis familiaris (dog) tRNALeu(UUR) 3’ A 5’ G C U A Acceptorstem U A A U G C U A G C A U G C A G U U G C A U C U C C G C U A G A C G C A G A G G C U U G C C U G C TYC-stem/loop U G A G U A A C U U C U A A G D-stem/loop A U A A U Anticodonstem/loop A U A C A C C U A U A A Wittenhagen, L.M. & Kelley, S.O., Nat. Struct. Biol. (2002) and Trends Biochem. Sci. (2003),

  24. So what? • This can be used to study the limits of tRNA stability in evolution • DM incompatibilities are intergenic, not expected to be revealed in F1 generation • Molecular basis of compensatory evolution is much more varied than has been appreciated • Fitness ridges of tRNAs are very epistatic such that 50% of all substitutions are compensatory • Fixation of CPD and/or Compensatory mutations occurs under positive selection

  25. Polymeropoulos MH, et al., Science, 1997

  26. Usual model of fitness: fitness potential f(p) = fitness, where p is the fitness potential such that p = c1a + c2b … + cnn where cnn is the total fitness contribution of allele (mutation) n This model cannot describe the evolutionary trajectory of CPDs.

  27. Fitness in colour: Low fitness Medium fitness High fitness Neutral case: (1,0) (1,1) CPD (0,0) (0,1) Compensatory

  28. Other types of CPD fitness surfaces (1,0) (1,1) (1,0) (1,1) CPD CPD (0,0) (0,1) (0,0) (0,1) Compensatory Compensatory (1,0) (1,1) (1,0) (1,1) CPD CPD (0,0) (0,1) (0,0) (0,1) Compensatory Compensatory

  29. Figure from DePristo et al. Nat. Genet. Rev. 2005

  30. Fitness: From DePristo et al. Nat. Genet. Rev. 2005

  31. Fitness Genotype Genotype

  32. Acknowledgements Alexey Kondrashov NCBI, NIH Shamil Sunyaev Harvard Medical School Andrew Kern University of California, Santa Cruz Financial Support National Science Foundation Graduate Research Fellowship

More Related