stability and compensated pathogenic deviations
Download
Skip this Video
Download Presentation
Stability and Compensated Pathogenic Deviations

Loading in 2 Seconds...

play fullscreen
1 / 36

Stability and Compensated Pathogenic Deviations - PowerPoint PPT Presentation


  • 266 Views
  • Uploaded on

Stability and Compensated Pathogenic Deviations. Fyodor A. Kondrashov Section of Ecology, Animal Behavior and Evolution University of California at San Diego. How can we make an elephant from scratch?. giraffe. elephant. TACG. ATGC. AT CG. Common ancestor. giraffe. ATGC. ATG G.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Stability and Compensated Pathogenic Deviations' - Patman


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
stability and compensated pathogenic deviations
Stability and Compensated Pathogenic Deviations

Fyodor A. Kondrashov

Section of Ecology, Animal Behavior and Evolution

University of California at San Diego

slide3
giraffe

elephant

TACG

ATGC

ATCG

Common ancestor

slide4
giraffe

ATGC

ATGG

ATCC

TTGC

AAGC

AAGG

ATCG

TTGG

TAGC

TTCC

AACC

TTCG

TAGG

TACC

AACG

Common ancestor

elephant

TACG

slide5
Ideal World Breeding

Real World Breeding

x

x

slide6
Fitness

Genotype

Genotype

slide7
MITOMAPA human mitochondrial genome database

A compendium of polymorphisms and mutations of the human mitochondrial DNA

Are human pathogenic mutations also pathogenic to closely related species?

slide9
Methods.

Genbank

22 tRNA multiple alignments with 106 mammals and with marked CPDs

ENTREZ

Phylogeny information

Complete mammalian mitochondrial genomes

FEDYA, ANDY,

TEXTPAD, mfold

EYES and PERL

Pathogenic mutations

Synteny preserved in most mammals (except marsupials)

CLUSTAWL

Multiple alignment

Secondary structure info

slide10
A multiple alignment of primate orthologs for Glycine (G) tRNA.

human actcttttagtataaat--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

chimpanzee actcttttagtataaGt--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

pygmy chimpanzee actcttttagtataaGc--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

gorilla actcttttagtataatt--agtaccgttaacttccaattaaccagttttggt-agtacccaaaaaagagta

orangutan actcttttagtataaGc--agtaccgttaacttccaattaaccagttttgac-aacactcaaaaaagagta

Sumatran orangutan actcttttagtataaac--agtaccgttaacttccaattaactagttttgac-aacGcccaaaaaagagta

hamadryas baboon actcttttagtataatt--agtacaAttgacttccaatcaatcagctttgac-aatattcaaaaaagagta

Barbary ape actcttttagtataacc--agtacaAttgacttccaatcaatcagttttgac-aacattcaaaaaagagta

common gibbon actcttttagtataaac--agtactgttaacttccaattaaccagcttcgat-aacGctcgaaaaagagta

capuchin attctcttagtataaac--agtacaAttgacttccaattaataggccttgat-aa-acccaagagagaata

ring-tailed lemur attcttttagtatcgacccaatacaAttgacttccaattaattaacttcggtgaa-aaccggaaaagaata

slow loris gctcttttagtacaact--agtacaAttgacttccaatcaataggatttggtaaataaccaaaagagagca

western tarsier gttcctttagtatcaatt-agtacaAttgacttccaatcaattagccctagtacaattctaggaaggaaca

. * . * *

slide11
A multiple alignment of selected mammalian orthologs for Luicine UUR (L1).

human gttaagatggcagagcccggtaatcgcataaaacttaaaactttacagt-cagaggttcaattcctcttcttaaca

western tarsier gttaagatggcagagcccggCaattgcataaaacttaaaactttattat-cagaggttcaactcctcttcttaaca

northern tree shrew gttaaggtggcagagcccggtcattgcctaaaacttaagattttaAgta-cagaagttcaaatcctctccttaaca

European hare gttaaggtggcagagcccggCaattgcataaaacttaaaactttataat-cagaggttcaactcctctccttaaca

Egyptian jerboa gctaagatggcagagcccggtaattgcaCaagacttaaaccCttgAatc-cagaggttcaactcctcttcttaGca

Eurasian red squirrel attaagatggcagagcccggcaattgcataagatttaaaacCttactat-cagaggttcaactcctcttcttaaTa

Madagascar hedgehog attaagatggcagagcc-ggtaattgcaCaagacttaaaccCttgctgt-cagaggttcaatCcctcttcttaaTa

little red flying fox gttaggatggcagagcccggCaattgcataaaacttaagcttttataat-cagaggttcaactcctcttcctaaca

Japanese house bat gttaaagtggcagagaccggtaattgcataaaacttaagattttagagc-cagaggttcaactcctctctttaaTa

polar bear gttagggtggcagagcccggtGattgcataaaacttaaacctttatact-cagaggttcaaatcctctccctaaca

Atlantic walrus gttagggtg-cagagcccggtaattgcataaaacttaaacttttacccc-cagaggttcaactcctctccctaaTa

greater Indian rhino gttaggatggcagagcccggtaactgcataaaacttaaacctttataac-cagaggttcaactcctcttcctaaca

narwhal gttgggatggcagagtacggCaattgcataaaacttaaacctttatacc-cagaggttcaaatcctcttcccaaca

Indus River dolphin gttgaggtggcagagtccggCaattgTataaaacttaaacttttacact-cagaggttcaaatcctctccccaaca

pig attagggtggcagagaccggtaattgcgtaaaacttaaacctttattac-cagaggttcaactcctctccctaaTa

nine-banded armadillo gttaagatggcagagacaggtaattgcataagacttaaacctttattac-cagaggttcaaatcctcttcttaaca

aardvark gttaaggtggcagagcccggtaattgcataaaacttaagcttttacaac-cagaggttcaattcctctccttaaca

Asiatic elephant gttaagatagcaaaaattggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

African elephant gttaagatagcaaaaactggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

wallaroo attaaggtggcagagcc-ggCaattgcataaaacttaaacctttataat-cagaggttcaaatcctctccttaaTa

common wombat attaaggtggcagagca-ggtaattgcataaaacttaagcctttacaac-cagaggttcaaaCcctctccttaaTa

platypus attaaggtgacagagaccggtaattgTgtaaaacttaagcttttatagt-cagaggttcaaatcctctccttaaTa

Australian echidna attaaggtgacagagaccggCaattgTgtaaaacttaagcttttataat-cagaggttcaaatcctctccttaaTa

. .**. . * * . . * . * * . * **

slide12
Compensated Pathogenic Deviation (CPD)

Molecular event (substitution or other) that is present in a wild-type in one species and is pathogenic in another species.

Compensatory Deviation

Molecular event (substitution or other) that negates the deleterious effect of a Pathogenic Mutation

slide13
Homo sapiens tRNAAsn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

U

G

U

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

C

G

U

A

U

A

Anticodonstem/loop

A

U

G

C

C

A

U

A

G

U

U

Can we say anything about a molecular or structural basis of compensations?

slide14
Pan troglodytes(chimpanzee) tRNAAsn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

G

U

A

U

A

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

U

A

C

U

A

G

U

A

A

U

Anticodonstem/loop

G

C

C

A

U

A

G

U

U

Figure 2a

slide15
Cynocephalus variegatus

(Malayan flying lemur) tRNALys

3’

A

Acceptorstem

5’

C

G

A

U

G

C

U

A

C

A

U

G

C

U

A

U

U

CA

C

G

C

A

D-stem/loop

A

C

C

C

U

U

C

A

A

C

A

U

U

G

G

A

A

G

G

U

C

G

A

C

U

A

U

C

A

A

C

G

A

G

A

C

A

A

U

A

A

TYC-stem/loop

U

U

G

A

U

A

U

A

A

U

Anticodonstem/loop

A

U

C

G

C

A

U

A

U

U

U

Figure 2b

slide16
human

CG

Common ancestor

CA

UG

UA

chimp

slide17
Ceratotherium simum

(white rhinoceros) tRNATrp

3’

G

5’

A

U

Acceptorstem

G

C

G

C

U

A

A

U

A

U

U

A

TYC-stem/loop

U

A

A

C

A

U

U

U

C

A

U

A

A

A

C

U

U

G

G

A

A

G

U

A

A

A

C

C

U

C

G

A

C

C

U

C

A

C

G

G

UA

A

A

D-stem/loop

A

A

U

C

G

C

A

G

C

Anticodonstem/loop

G

A

C

C

G

C

A

U

A

U

A

C

Figure 2c

slide18
Ursus maritimus(polar bear) tRNASer(UCN)

3’

A

5’

G

U

A

U

A

U

G

C

A

U

Acceptorstem

A

G

U

U

A

U

G

C

C

U

A

U

G

A

C

U

U

C

C

A

G

G

U

A

U

A

G

A

G

G

G

C

C

G

G

U

U

A

U

U

A

U

G

G

G

C

U

TYC-stem/loop

U

A

C

C

U

G

C

U

A

U

G

D-stem/loop

C

G

U

A

G

U

A

Anticodonstem/loop

G

C

G

C

C

A

U

A

U

A

G

Figure 2d

slide19
Spalax ehrenbergi(Ehrenberg's mole-rat) tRNAIle

3’

A

5’

A

U

G

C

Acceptorstem

A

U

A

U

TYC-stem/loop

A

U

A

C

G

U

A

U

A

C

G

U

U

C

U

C

C

A

U

G

A

A

G

A

G

G

A

G

C

C

U

C

U

U

U

A

A

A

G

C

A

G

A

A

UU

C

A

G

A

U

A

U

A

D-stem/loop

A

U

G

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A

Figure 2e

slide20
Tamandua tetradactyla

(southern tamandua) tRNAIle

3’

A

5’

A

U

G

C

A

U

Acceptorstem

A

U

TYC-stem/loop

A

U

U

A

C

A

A

U

G

C

U

A

U

C

U

C

C

U

U

C

G

A

A

G

A

G

G

A

G

C

C

U

C

U

C

A

U

A

A

A

G

A

G

G

A

U

A

U

C

C

A

D-stem/loop

U

A

A

A

A

U

U

G

U

A

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A

slide21
Hyperoodon ampullatus

(northern bottlenose whale) tRNALeu(UUR)

3’

A

5’

G

C

Acceptorstem

U

A

U

A

U

G

C

A

G

U

A

U

G

C

D-stem/loop

G

C

A

C

U

A

U

U

A

U

C

U

C

C

C

G

U

A

C

G

A

G

A

C

G

A

G

A

G

G

U

C

U

U

C

G

C

U

G

U

C

TYC-stem/loop

U

G

A

C

A

C

G

A

C

C

U

A

U

C

U

A

A

U

Anticodonstem/loop

A

U

A

U

C

A

U

C

A

C

U

A

A

U

A

Figure 2f

slide22
Tachyglossus aculeatus

(Australian echidna) tRNALeu(UUR)

3’

A

5’

A

U

C

G

U

A

U

A

Acceptorstem

A

U

A

U

U

G

C

D-stem/loop

A

G

C

U

C

A

U

G

A

U

C

U

C

C

U

G

A

A

A

C

G

A

G

A

G

G

C

G

A

C

A

C

U

U

C

G

TYC-stem/loop

U

U

U

G

U

G

A

A

C

A

G

A

C

C

G

U

U

U

A

A

A

U

C

A

U

Anticodonstem/loop

A

U

C

A

U

C

C

A

U

G

A

U

A

A

slide23
Oryctolagus cuniculus

(rabbit) tRNACys

3’

U

5’

A

U

G

C

C

G

U

C

G

C

G

A

C

C

U

G

G

C

A

C

A

A

C

G

U

C

U

A

G

G

U

C

G

C

A

G

C

G

G

U

G

A

U

U

A

C

A

C

A

U

U

A

A

A

G

A

U

U

A

U

G

U

A

G

C

A

U

A

U

U

A

U

A

G

A

C

slide24
Canis familiaris

(dog) tRNALeu(UUR)

3’

A

5’

G

C

U

A

Acceptorstem

U

A

A

U

G

C

U

A

G

C

A

U

G

C

A

G

U

U

G

C

A

U

C

U

C

C

G

C

U

A

G

A

C

G

C

A

G

A

G

G

C

U

U

G

C

C

U

G

C

TYC-stem/loop

U

G

A

G

U

A

A

C

U

U

C

U

A

A

G

D-stem/loop

A

U

A

A

U

Anticodonstem/loop

A

U

A

C

A

C

C

U

A

U

A

A

Wittenhagen, L.M. & Kelley, S.O.,

Nat. Struct. Biol. (2002) and

Trends Biochem. Sci. (2003),

slide27
So what?
  • This can be used to study the limits of tRNA stability in evolution
  • DM incompatibilities are intergenic, not expected to be revealed in F1 generation
  • Molecular basis of compensatory evolution is much more varied than has been appreciated
  • Fitness ridges of tRNAs are very epistatic such that 50% of all substitutions are compensatory
  • Fixation of CPD and/or Compensatory mutations occurs under positive selection
slide30
Usual model of fitness: fitness potential

f(p) = fitness, where p is the fitness potential such that

p = c1a + c2b … + cnn

where cnn is the total fitness contribution of allele (mutation) n

This model cannot describe the evolutionary trajectory of CPDs.

slide31
Fitness in colour:

Low fitness Medium fitness High fitness

Neutral case:

(1,0)

(1,1)

CPD

(0,0)

(0,1)

Compensatory

slide32
Other types of CPD fitness surfaces

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory

slide34
Fitness:

From DePristo et al. Nat. Genet. Rev. 2005

slide35
Fitness

Genotype

Genotype

slide36
Acknowledgements

Alexey Kondrashov NCBI, NIH

Shamil Sunyaev Harvard Medical School

Andrew Kern University of California, Santa Cruz

Financial Support

National Science Foundation Graduate Research Fellowship

ad