multiple sequence alignment l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Multiple sequence alignment PowerPoint Presentation
Download Presentation
Multiple sequence alignment

Loading in 2 Seconds...

play fullscreen
1 / 42

Multiple sequence alignment - PowerPoint PPT Presentation


  • 504 Views
  • Uploaded on

Multiple sequence alignment. Why we do multiple alignments?. Multiple nucleotide or amino sequence alignment techniques are usually performed to fit one of the following scopes :

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Multiple sequence alignment' - Patman


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
why we do multiple alignments
Why we do multiple alignments?
  • Multiple nucleotide or amino sequence alignment techniques are usually performed to fit one of the following scopes :
  • In order to characterize protein families, identify shared regions of homology in a multiple sequence alignment; (this happens generally when a sequence search revealed homologies to several sequences)
  • Determination of the consensus sequence of several aligned sequences.
why we do multiple alignments3
Why we do multiple alignments?
  • Help prediction of the secondary and tertiary structures of new sequences;
  • Preliminary step in molecular evolution analysis using Phylogenetic methods for constructing phylogenetic trees.
an example of multiple alignment
An example of Multiple Alignment

VTISCTGSSSNIGAG-NHVKWYQQLPG

VTISCTGTSSNIGS--ITVNWYQQLPG

LRLSCSSSGFIFSS--YAMYWVRQAPG

LSLTCTVSGTSFDD--YYSTWVRQPPG

PEVTCVVVDVSHEDPQVKFNWYVDG--

ATLVCLISDFYPGA--VTVAWKADS--

AALGCLVKDYFPEP--VTVSWNSG---

VSLTCLVKGFYPSD--IAVEWWSNG--

multiple alignment method
Multiple Alignment Method
  • The most practical and widely used method in multiple sequence alignment is the hierarchical extensions of pairwise alignment methods.
  • The principal is that multiple alignments is achieved by successive application of pairwise methods.
multiple alignment method6
Multiple Alignment Method
  • The steps are summarized as follows:
  • Compare all sequences pairwise.
  • Perform cluster analysis on the pairwise data to generate a hierarchy for alignment. This may be in the form of a binary tree or a simple ordering
  • Build the multiple alignment by first aligning the most similar pair of sequences, then the next most similar pair and so on. Once an alignment of two sequences has been made, then this is fixed. Thus for a set of sequences A, B, C, D having aligned A with C and B with D the alignment of A, B, C, D is obtained by comparing the alignments of A and C with that of B and D using averaged scores at each aligned position.
choosing sequences for alignment general considerations
Choosing sequences for alignmentGeneral considerations
  • The more sequences to align the better.
  • Don’t include similar (>80%) sequences.
  • Sub-groups should be pre-aligned separately, and one member of each subgroup should be included in the final multiple alignment.
multiple alignment in gcg
Multiple alignment in GCG
  • The program available in GCG for multiple alignment is Pileup.
  • The input file for Pileup is a list of sequence file_names or sequence codes in the database, created by a text editor.
  • Pileup creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment.
  • Please note that there is no one absolute alignment, even for a limited number of sequences.
choosing sequences for pileup
Choosing sequences for PileUp

As far as possible, try to align sequences of similar length.

Pileup can align sequences of up to 5000 residues, with 2000 gaps (total 7000 characters).

Pileup is a good program only for similar (close) sequences.

output of pileup
Output of Pileup

!!NA_MULTIPLE_ALIGNMENT 1.0

PileUp of: @tnf.list

Symbol comparison table: GenRunData:pileupdna.cmp CompCheck: 6876

GapWeight: 5

GapLengthWeight: 1

tnf.msf MSF: 1706 Type: N August 12, 1997 08:10 Check: 5044 ..

Name: OATNFA1 Len: 1706 Check: 5831 Weight: 1.00

Name: OATNFAR Len: 1706 Check: 7533 Weight: 1.00

Name: BSPTNFA Len: 1706 Check: 1732 Weight: 1.00

Name: CEU14683 Len: 1706 Check: 6670 Weight: 1.00

Name: HSTNFR Len: 1706 Check: 191 Weight: 1.00

Name: SYNTNFTRP Len: 1706 Check: 3706 Weight: 1.00

Name: CATTNFAA Len: 1706 Check: 7430 Weight: 1.00

Name: CFTNFA Len: 1706 Check: 2566 Weight: 1.00

Name: RABTNFM Len: 1706 Check: 5089 Weight: 1.00

Name: RNTNFAA Len: 1706 Check: 4296 Weight: 1.00

output of pileup12
Output of Pileup

//

1

OATNFA1 ~~~~~~~~~~ ~~~~~~~~~~ ~GGCCAAGAG

OATNFAR ~~~~~GGGAC ACCAGGGGAC CAGCCAAGAG

BSPTNFA ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~

CEU14683 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~

HSTNFR ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~GCAGA

SYNTNFTRP AGCAGACGCT CCCTCAGCAA GGACAGCAGA

CATTNFAA ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~

CFTNFA ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~

RABTNFM ~~~~AAGCTC CCTCAGTGAG GACACGGGCA

RNTNFAA ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~

output of pileup13
Output of Pileup

401

OATNFA1 TTCAG..... .ACACTCAGG TCATCTTCTC AAGC

OATNFAR TTCAG..... .ACACTCAGG TCATCTTCTC AAGC

BSPTNFA TTCAA..... .ACACTCAGG TCCTCTTCTC AAGC

CEU14683 TTCAG..... .ACCCTCAGG TCATCTTCTC AAGC

HSTNFR CCCAG..... .GCAGTCAGA TCATCTTCTC GAAC

SYNTNFTRP CCCAG..... .GCAGTCAGA TCATCTTCTC GAAC

CATTNFAA CCCAG..... .ACACTCAGA TCATCTTCTC GAAC

CFTNFA TCCAG..... .ACAGTCAAA TCATCTTCTC GAAC

RABTNFM CCCAGATGGT CACCCTCAGA TCAGCTTCTC GGGC

RNTNFAA CCCAGACCCT CACACTCAGA TCATCTTCTC AAAA

pileup considirations
PileUp considirations

PileUp does global multiple alignment, and therefore is good for a group of similar sequences.

PileUp will fail to find the bestlocal region of similarity (such as a shared motif) among distant related sequences.

PileUp always aligns all of the sequences you specified in the input file, even if they are not related. The alignment can be degraded if some of the sequences are only distantly related.

pileup special options
Pileup special options
  • Creating an end-weighted alignment: -ENDWeight
  • Realigning part of an existing alignment: -INSitu -Begin=XX -END=YYwhere XX and YY specify the exact positions to begin (XX) and end (YY) the realignment.
displaying a multiple alignment in gcg
Displaying a multiple alignment in GCG

There are several programs to display the multiple alignment prettily.

The Pretty program prints sequences with their columns aligned and can display a consensus for the alignment, allowing you to look at relationships among the sequences.

The PrettyBox program displays the alignment graphically with the conserved regions of the alignment as shaded boxes. The output is in Postscript format.

shadybox
ShadyBox

ShadyBox is a multiple alignment editor program which enables you to box and shade residues or segments of multiple aligned sequences.

ShadyBox will work on a msf or pretty output file, and will produce a postscript output file. The original input file is not changed.

ShadyBox enables you to save your work in the middle, exit the program, and resume at a later stage.

clustalw for multiple alignment
ClustalW- for multiple alignment
  • ClustaW is a general purpose multiple alignment program for DNA or proteins.
  • ClustalW is produced by Julie D. Thompson, Toby Gibson of European Molecular Biology Laboratory, Germany and Desmond Higgins of European Bioinformatics Institute, Cambridge, UK. Algorithmic
  • ClustalW is cited: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680.
clustalw for multiple alignment22
ClustalW- for multiple alignment

ClustalW can create multiple alignments, manipulate existing alignments, do profile analysis and create phylogentic trees.

Alignment can be done by 2 methods:

- slow/accurate

- fast/approximate

running clustalw
Running ClustalW

[~]% clustalw

**************************************************************

******** CLUSTAL W (1.7) Multiple Sequence Alignments ********

**************************************************************

1. Sequence Input From Disc

2. Multiple Alignments

3. Profile / Structure Alignments

4. Phylogenetic trees

S. Execute a system command

H. HELP

X. EXIT (leave program)

Your choice:

running clustalw24
Running ClustalW

The input file for clustalW is a file containing all

sequences in one of the following formats:

NBRF/PIR, EMBL/SwissProt, Pearson (Fasta),

GDE, Clustal, GCG/MSF, RSF.

using clustalw
Using ClustalW

****** MULTIPLE ALIGNMENT MENU ******

1. Do complete multiple alignment now (Slow/Accurate)

2. Produce guide tree file only

3. Do alignment using old guide tree file

4. Toggle Slow/Fast pairwise alignments = SLOW

5. Pairwise alignment parameters

6. Multiple alignment parameters

7. Reset gaps between alignments? = OFF

8. Toggle screen display = ON

9. Output format options

S. Execute a system command

H. HELP

or press [RETURN] to go back to main menu

Your choice:

output of clustalw
Output of ClustalW

CLUSTAL W (1.7) multiple sequence alignment

HSTNFR GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAG

SYNTNFTRP GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAG

CFTNFA -------------------------------------------TGTCCAG------ACAG

CATTNFAA GGGAAGAG---CTCCCACATGGCCTGCAACTAATCAACCCTCTGCCCCAG------ACAC

RABTNFM AGGAGGAAGAGTCCCCAAACAACCTCCATCTAGTCAACCCTGTGGCCCAGATGGTCACCC

RNTNFAA AGGAGGAGAAGTTCCCAAATGGGCTCCCTCTCATCAGTTCCATGGCCCAGACCCTCACAC

OATNFA1 GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACAC

OATNFAR GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACAC

BSPTNFA GGGAAGAGCAGTCCCCAGGTGGCCCCTCCATCAACAGCCCTCTGGTTCAA------ACAC

CEU14683 GGGAAGAGCAATCCCCAACTGGCCTCTCCATCAACAGCCCTCTGGTTCAG------ACCC

** *

clustalw options
ClustalW options

Your choice: 5

********* PAIRWISE ALIGNMENT PARAMETERS *********

Slow/Accurate alignments:

1. Gap Open Penalty :15.00

2. Gap Extension Penalty :6.66

3. Protein weight matrix :BLOSUM30

4. DNA weight matrix :IUB

Fast/Approximate alignments:

5. Gap penalty :5

6. K-tuple (word) size :2

7. No. of top diagonals :4

8. Window size :4

9. Toggle Slow/Fast pairwise alignments = SLOW

H. HELP

Enter number (or [RETURN] to exit):

clustalw options28
ClustalW options

Your choice: 6

********* MULTIPLE ALIGNMENT PARAMETERS *********

1. Gap Opening Penalty :15.00

2. Gap Extension Penalty :6.66

3. Delay divergent sequences :40 %

4. DNA Transitions Weight :0.50

5. Protein weight matrix :BLOSUM series

6. DNA weight matrix :IUB

7. Use negative matrix :OFF

8. Protein Gap Parameters

H. HELP

Enter number (or [RETURN] to exit):

clustalx multiple sequence alignment program
ClustalX - Multiple Sequence Alignment Program
  • ClustalX provides a new window-based user interface to the ClustalW program.
  • It uses the Vibrant multi-platform user interface development library, developed by the National Center for Biotechnology Information (Bldg 38A, NIH 8600 Rockville Pike,Bethesda, MD 20894) as part of their NCBI SOFTWARE DEVELOPEMENT TOOLKIT.
blocks database and tools
Blocks database and tools
  • Blocks are multiply aligned ungapped segments corresponding to the most highly conserved regions of proteins.
  • The Blocks web server tools are : Block Searcher, Get Blocks and Block Maker. These are aids to detection and verification of protein sequence homology.
  • They compare a protein or DNA sequence to a database of protein blocks, retrieve blocks, and create new blocks,respectively.
the blocks web server
The BLOCKS web server

At URL: http://blocks.fhcrc.org/

The BLOCKS WWW server can be used to create blocks of a group of sequences, or to compare a protein sequence to a database of blocks.

The Blocks Searcher tool should be used for multiple alignment of distantly related protein sequences.

the blocks searcher tool
The Blocks Searcher tool
  • For searching a database of blocks, the first position of the sequence is aligned with the first position of the first block, and a score for that amino acid is obtained from the profile column corresponding to that position. Scores are summed over the width of the alignment, and then the block is aligned with the next position.
  • This procedure is carried out exhaustively for all positions of the sequence for all blocks in the database, and the best alignments between a sequence and entries in the BLOCKS database are noted. If a particular block scores highly, it is possible that the sequence is related to the group of sequences the block represents.
the blocks searcher tool39
The Blocks Searcher tool
  • Typically, a group of proteins has more than one region in common and their relationship is represented as a series of blocks separated by unaligned regions. If a second block for a group also scores highly in the search, the evidence that the sequence is related to the group is strengthened, and is further strengthened if a third block also scores it highly, and so on.
the blocks database
The BLOCKS Database

The blocks for the BLOCKS database are made automatically by looking for the most highly conserved regions in groups of proteins represented in the PROSITE database. These blocks are then calibrated against the SWISS-PROT database to obtain a measure of the chance distribution of matches. It is these calibrated blocks that make up the BLOCKS database.

the block maker tool
The Block Maker Tool

Block Maker finds conserved blocks in a group of two or more unaligned protein sequences, which are assumed to be related, using two different algorithms.

Input file must contain at least 2 sequences.

Input sequences must be in FastA format.

Results are returned by e-mail.