MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger - PowerPoint PPT Presentation

Audrey
slide1 l.
Skip this Video
Loading SlideShow in 5 Seconds..
MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger PowerPoint Presentation
Download Presentation
MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger

play fullscreen
1 / 50
Download Presentation
MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger
408 Views
Download Presentation

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger http://cs273a.stanford.edu [Bejerano Aut08/09]

  2. Lecture 13 • HW1+2 • Non Coding Transcripts http://cs273a.stanford.edu [Bejerano Aut08/09]

  3. hg18.chr3:3,990,437-4,003,094

  4. Zoom out of hg18.chr3:3,990,437-4,003,094 Mouse inversion Mm9 Browser

  5. hg18.chr9:38,764,619-38,905,426

  6. Zoom out of hg18.chr9:38,764,619-38,905,426 Human Duplication

  7. Meet Your Genome contd. [Human Molecular Genetics, 3rd Edition] http://cs273a.stanford.edu [Bejerano Aut08/09]

  8. Most Non-Coding Elements are likely cis-regulatory “IRX1 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.” gene deserts regulatory jungles 9Mb http://cs273a.stanford.edu [Bejerano Aut08/09]

  9. Structural RNAs http://cs273a.stanford.edu [Bejerano Aut08/09]

  10. Central Dogma of Biology:

  11. RNA is an Active Player:

  12. What is ncRNA? • Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein. • Known roles for ncRNAs: • RNA catalyzes excision/ligation in introns. • RNA catalyzes the maturation of tRNA. • RNA catalyzes peptide bond formation. • RNA is a required subunit in telomerase. • RNA plays roles in immunity and development (RNAi). • RNA plays a role in dosage compensation. • RNA plays a role in carbon storage. • RNA is a major subunit in the SRP, which is important in protein trafficking. • RNA guides RNA modification.

  13. The modern world The RNA world DNA RNA RNA Proteins information flow Information carryer replication

  14. Predicting RNA Secondary and 3D Structure from Sequence: AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA Cate, et al. (Cech & Doudna). (1996) Science 273:1678. Waring & Davies. (1984) Gene 28: 277.

  15. http://cs273a.stanford.edu [Bejerano Aut08/09]

  16. http://cs273a.stanford.edu [Bejerano Aut08/09]

  17. MP MP MP ML ML ML G A A A – U G – C G – C RNA sequence analysis - SCFGs G G A A G A U C C < < < . . . > > >

  18. http://cs273a.stanford.edu [Bejerano Aut08/09]

  19. http://cs273a.stanford.edu [Bejerano Aut08/09]

  20. http://cs273a.stanford.edu [Bejerano Aut08/09]

  21. http://cs273a.stanford.edu [Bejerano Aut08/09]

  22. MicroRNA http://cs273a.stanford.edu [Bejerano Aut08/09]

  23. Genomic context 180 known miRNAs in human 130 intergenic 50 intronic 60 polycistronic 70 monocistronic

  24. AAAAAAA ncRNA gene contexts tRNA, snRNAs,SRP, RNase P ….. Xist miRNAs miRNAs, snoRNAs

  25. Example: tRNA Bafna

  26. http://cs273a.stanford.edu [Bejerano Aut08/09]

  27. Human Specific Rapid Evolution maximally changed m c h r m h r 100%id 100%id http://cs273a.stanford.edu [Bejerano Aut08/09]

  28. Human accelerated http://cs273a.stanford.edu [Bejerano Aut08/09]

  29. Nearest Neighbor Model for RNA Secondary Structure Free Energy at 37 OC: Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287. http://cs273a.stanford.edu [Bejerano Aut08/09]

  30. RNA structure: Basics • Key: RNA is single-stranded. Think of a string over 4 letters, AC,G, and U. • The complementary bases form pairs. • Base-pairing defines a secondary structure. The base-pairing is usually non-crossing. Bafna

  31. http://cs273a.stanford.edu [Bejerano Aut08/09]

  32. Unfortunately… • Random DNA (with high GC content) often folds into low-energy structures. • What other signals determine non-coding genes? Bafna

  33. http://cs273a.stanford.edu [Bejerano Aut08/09]

  34. RNA structure: pseudoknots • Sometimes, unpaired bases in loops form ‘crossing pairs’. These are pseudoknots. Bafna

  35. Other Non Coding Transcripts http://cs273a.stanford.edu [Bejerano Aut08/09]

  36. http://cs273a.stanford.edu [Bejerano Aut08/09]

  37. mRNA http://cs273a.stanford.edu [Bejerano Aut08/09]

  38. EST http://cs273a.stanford.edu [Bejerano Aut08/09]

  39. Microarrays http://cs273a.stanford.edu [Bejerano Aut08/09]

  40. Transcript Ends http://cs273a.stanford.edu [Bejerano Aut08/09]

  41. Transcript mapping Affy arrays CAGE, SAGE, diTAGS, etc. http://cs273a.stanford.edu [Bejerano Aut08/09]

  42. End Picture http://cs273a.stanford.edu [Bejerano Aut08/09]

  43. Transcripts, transcripts everywhere Human Genome Leaky tx? Functional? Transcribed (Tx) Tx from both strands http://cs273a.stanford.edu [Bejerano Aut08/09]

  44. http://cs273a.stanford.edu [Bejerano Aut08/09]

  45. http://cs273a.stanford.edu [Bejerano Aut08/09]

  46. http://cs273a.stanford.edu [Bejerano Aut08/09]

  47. http://cs273a.stanford.edu [Bejerano Aut08/09]

  48. X Dosage compensation X chromosome inactivation in mammals X Y X X

  49. Avner and Heard, Nat. Rev. Genetics 2001 2(1):59-67 Xist – X inactive-specific transcript

  50. Meet Your Genome the end? [Human Molecular Genetics, 3rd Edition] http://cs273a.stanford.edu [Bejerano Aut08/09]