slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger PowerPoint Presentation
Download Presentation
MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger

Loading in 2 Seconds...

play fullscreen
1 / 50

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger - PowerPoint PPT Presentation


  • 405 Views
  • Uploaded on

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger Lecture 13 HW1+2 Non Coding Transcripts hg18.chr3:3,990,437-4,003,094 Zoom out of hg18.chr3:3,990,437-4,003,094 Mouse inversion Mm9 Browser hg18.chr9:38,764,619-38,905,426

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger' - Audrey


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

MW  11:00-12:15 in Beckman B302

Profs: Serafim Batzoglou, Gill Bejerano

TAs: Cory McLean, Aaron Wenger

http://cs273a.stanford.edu [Bejerano Aut08/09]

lecture 13
Lecture 13
  • HW1+2
  • Non Coding Transcripts

http://cs273a.stanford.edu [Bejerano Aut08/09]

meet your genome contd
Meet Your Genome contd.

[Human Molecular Genetics, 3rd Edition]

http://cs273a.stanford.edu [Bejerano Aut08/09]

most non coding elements are likely cis regulatory
Most Non-Coding Elements are likely cis-regulatory

“IRX1 is a member of the Iroquois homeobox gene family.

Members of this family appear to play multiple roles

during pattern formation of vertebrate embryos.”

gene deserts

regulatory jungles

9Mb

http://cs273a.stanford.edu [Bejerano Aut08/09]

slide9

Structural RNAs

http://cs273a.stanford.edu [Bejerano Aut08/09]

slide12

What is ncRNA?

  • Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein.
  • Known roles for ncRNAs:
    • RNA catalyzes excision/ligation in introns.
    • RNA catalyzes the maturation of tRNA.
    • RNA catalyzes peptide bond formation.
    • RNA is a required subunit in telomerase.
    • RNA plays roles in immunity and development (RNAi).
    • RNA plays a role in dosage compensation.
    • RNA plays a role in carbon storage.
    • RNA is a major subunit in the SRP, which is important in protein trafficking.
    • RNA guides RNA modification.
slide13

The modern world

The RNA world

DNA

RNA

RNA

Proteins

information flow

Information carryer replication

slide14

Predicting RNA Secondary and 3D Structure from Sequence:

AAUUGCGGGAAAGGGGUCAA

CAGCCGUUCAGUACCAAGUC

UCAGGGGAAACUUUGAGAUG

GCCUUGCAAAGGGUAUGGUA

AUAAGCUGACGGACAUGGUC

CUAACCACGCAGCCAAGUCC

UAAGUCAACAGAUCUUCUGU

UGAUAUGGAUGCAGUUCA

Cate, et al. (Cech & Doudna).

(1996) Science 273:1678.

Waring & Davies. (1984) Gene 28: 277.

rna sequence analysis scfgs

MP

MP

MP

ML

ML

ML

G

A

A

A – U

G – C

G – C

RNA sequence analysis - SCFGs

G G A A G A U C C

< < < . . . > > >

microrna
MicroRNA

http://cs273a.stanford.edu [Bejerano Aut08/09]

genomic context
Genomic context

180 known miRNAs in human

130 intergenic

50 intronic

60 polycistronic

70 monocistronic

ncrna gene contexts

AAAAAAA

ncRNA gene contexts

tRNA, snRNAs,SRP, RNase P …..

Xist

miRNAs

miRNAs, snoRNAs

human specific rapid evolution
Human Specific Rapid Evolution

maximally changed

m

c

h

r

m

h

r

100%id

100%id

http://cs273a.stanford.edu [Bejerano Aut08/09]

human accelerated
Human accelerated

http://cs273a.stanford.edu [Bejerano Aut08/09]

slide29

Nearest Neighbor Model for RNA Secondary Structure Free Energy at 37 OC:

Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287.

http://cs273a.stanford.edu [Bejerano Aut08/09]

rna structure basics
RNA structure: Basics
  • Key: RNA is single-stranded. Think of a string over 4 letters, AC,G, and U.
  • The complementary bases form pairs.
  • Base-pairing defines a secondary structure. The base-pairing is usually non-crossing.

Bafna

unfortunately
Unfortunately…
  • Random DNA (with high GC content) often folds into low-energy structures.
  • What other signals determine non-coding genes?

Bafna

rna structure pseudoknots
RNA structure: pseudoknots
  • Sometimes, unpaired bases in loops form ‘crossing pairs’. These are pseudoknots.

Bafna

slide35

Other Non Coding Transcripts

http://cs273a.stanford.edu [Bejerano Aut08/09]

slide37
mRNA

http://cs273a.stanford.edu [Bejerano Aut08/09]

slide38
EST

http://cs273a.stanford.edu [Bejerano Aut08/09]

microarrays
Microarrays

http://cs273a.stanford.edu [Bejerano Aut08/09]

transcript ends
Transcript Ends

http://cs273a.stanford.edu [Bejerano Aut08/09]

transcript mapping
Transcript mapping

Affy arrays

CAGE, SAGE, diTAGS, etc.

http://cs273a.stanford.edu [Bejerano Aut08/09]

end picture
End Picture

http://cs273a.stanford.edu [Bejerano Aut08/09]

transcripts transcripts everywhere
Transcripts, transcripts everywhere

Human Genome

Leaky tx?

Functional?

Transcribed (Tx)

Tx from both strands

http://cs273a.stanford.edu [Bejerano Aut08/09]

meet your genome the end
Meet Your Genome the end?

[Human Molecular Genetics, 3rd Edition]

http://cs273a.stanford.edu [Bejerano Aut08/09]