1 / 45

Selection does occur in NT

Selection does occur in NT. Most variation has little effect on fitness. Testing the Neutral theory. Synonymous vs Nonsynonymous substitutions Microadaptation within protein coding genes Types of selection “positive”. Evolutionary change in Nucleotide sequence. Basic Process

zahina
Download Presentation

Selection does occur in NT

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Selection does occur in NT • Most variation has little effect on fitness

  2. Testing the Neutral theory • Synonymous vs Nonsynonymous substitutions • Microadaptation within protein coding genes • Types of selection “positive”

  3. Evolutionary change in Nucleotide sequence • Basic Process • Estimating rates of substitution • Reconstructing organism phylogeny

  4. Compare two or more sequences descended from a common ancestor

  5. Purines     Pyrimidines  A G C T

  6. Models of Nucleotide Sub. • Jukes-Cantor • assumes that all nucleotides are present with equal frequencies • assumes equal probabilities for all possible nucleotide substitutions • Kimura 2-parameter • assumes that all nucleotides are present with equal frequencies • assumes Ti () and Tv (β) probabilities are different

  7. 3 Sub. Types Tv, 2 Ti Equal base frequencies 3 Sub. Types 2 Tv classes, Ti 2 Sub. Types Tv vs. Ti Equal base frequencies 2 Sub. Types Tv vs. Ti Single sub. type Equal base frequencies Single sub. type GTR TrN SYM K3ST HKY85 F84 F81 K2P JC

  8. Jukes and Cantor (1969) • If you have an A at site i it will change to G, T, C with equal probability • Thus the rate of substitution per unit time is 3. • The rate of sub. in each of the 3 possible directions of change is 

  9. Jukes and Cantor (1969) cont. • What is the prob. that this site is occupied by A at time t? PA(t) • The prob. that this site is occupied by A at time 0 isPA(0)=1and still having A time 1 PA(1)= 1-3

  10. Jukes and Cantor (1969) cont. A A T=0 No sub. sub. Not A A T=1 No sub. sub. A A T=2 The prob. of A at time 2 is PA(2) = (1-3) PA(1)+[1-PA(1)]

  11. Continuous time model

  12. Purines Pyrimidines Kimura 2 Parameter  A G   β β C T 

  13. Kimura Scenario’s A A A A T=0 No sub. Ti. Tv. Tv. T=1 G A C T No sub. Ti. Tv. Tv. T=2 A A A A

  14. 3 Sub. Types Tv, 2 Ti Equal base frequencies 3 Sub. Types 2 Tv classes, Ti 2 Sub. Types Tv vs. Ti Equal base frequencies 2 Sub. Types Tv vs. Ti Single sub. type Equal base frequencies Single sub. type GTR TrN SYM K3ST HKY85 F84 F81 K2P JC

  15. Substitutions Time 0 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....C......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....C...........A............. Taxon 4) .....G...........A........G....

  16. Substitutions Time 1 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....A......T.................. Taxon 2) .....G......G........C......... Taxon 3) .....G...........A............. Taxon 4) .....G...........A........G....

  17. Substitutions Time 2 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....G......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....G...........A............. Taxon 4) .....G...........A........G.... Multiple Substitutions at the same site

  18. Hamming Distance or P=n/N*100 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....C......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....C...........A............. Taxon 4) .....G...........A........G.... N=31 P=2/31*100=6.45%

  19. Substitutions Time 2 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....G......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....G...........A............. Taxon 4) .....G...........A........G.... A→C→G P=2/31*100=6.45%

  20. Nucleotide diff. between seq. Prob. at time t = PAA(t) For both seq. the prob. at time t = P2AA(t)

  21. I(t) = Prob. That the nucleotide at a given site at time t is the same in both sequences I(t) = P2AA(t) + P2 AT(t) P2AC(t) + P2AG(t)

  22. Same as in the JC For 2 sequences Note that the prob. the 2 seq. are different at the site at time t is P = 1-I(t)

  23. JC model Problem, we do not know t

  24. K = the # of substitutions per site since the time of divergence between the two sequences K = 2(3t) where (3t) is the number of sub. between a single lineage

  25. JC model # of substitutions per site since the time of divergence

  26. K2 model

  27. Table 3.2 The one-parameter (jukes and Cantor 1969) and four-parameter (Blaisdell 1985) schemes of nucleotide substitution in matrix forma

  28. Table 3.1 General matrix of nucleotide substitutiona

  29. 3 Sub. Types Tv, 2 Ti Equal base frequencies 3 Sub. Types 2 Tv classes, Ti 2 Sub. Types Tv vs. Ti Equal base frequencies 2 Sub. Types Tv vs. Ti Single sub. type Equal base frequencies Single sub. type GTR TrN SYM K3ST HKY85 F84 F81 K2P JC

  30. So Which model? • Multiple assumptions (= nuc. freq. to start etc). • Sampling errors due to the use of logarithmic functions (zero).

  31. Comparison of Distance Measures

  32. Protein encoding genes • Synonymous and Nonsynonymous • Very difficult as a site changes over time • CGG (arg) 3rd position is syn. But if 1st pos mutates to T then the 3rd position of the resulting codon becoming Nonsynonymous • Many sites are not completely synonymous or nonsynonymous • Depending the type of mutation, a TI at the 3rd position of CGG (arg) is syn, whereas a TV is nonsynonymous

  33. Genetic Code – Note degeneracy of 1st vs 2nd vs 3rd position sites

  34. Genetic Code Four-fold degenerate site – Any substitution is synonymous

  35. Genetic Code Two-fold degenerate site – Some substitutions synonymous, some non-synonymous

  36. Measuring Selection on Genes • Null hypothesis = neutral evolution • Under neutral evolution, synonymous changes should accumulate at a rate equal to mutation rate • Under neutral evolution, amino acid substitutions should also accumulate at a rate equal to the mutation rate

  37. Counting #s/#a Ser Ser Ser Ser Ser Species1 TGA TGC TGT TGT TGT Ser Ser Ser Ser Ala Species2 TGT TGT TGT TGT GGT #s = 2 sites #a = 1 site #a/#s=0.5 To assess selection pressures one needs to calculate the rates (Ka, Ks), i.e. the occurring substitutions as a fraction of the possible syn. and nonsyn. substitutions. Things get more complicated, if one wants to take transition transversion ratios and codon bias into account. See chapter 4 in Nei and Kumar, Molecular Evolution and Phylogenetics.

  38. Multiple ways to calculate Ks & Ka • Li et al., 1985 • Classify the nucleotides into: • nondegenerate: all changes at the site are nonsyn. • twofold degenerate: 1 of 3 is synonymous • fourfold degenerate: all 3 are syn.

  39. Categorize degeneracy, • Further separate on mutation types (transitional, or transversional) for each type of degeneracy. • Ks: the number of synonymous substitutions per synonymous site • Ka: the number of nonsynonymous substitutions per nonsynonymous site

  40. Why? • Study evolution • Positive selection • Negative selection

More Related