1 / 1

16S amplicon

Ligation Detection Reaction. Pfu DNA Ligase. Discriminating oligo. Common Probe. Cy3. OH. P. cZip code. GCAATTACGGATT. CGCIIATTTAC G. 16S amplicon. GCGIITAAATG C CGTTAATGCCTAA. Perfect match. Ligation product. Cy3. cZip code. CGCIIATTTAC G GCAATTACGGATT A. A.

yitta
Download Presentation

16S amplicon

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Ligation Detection Reaction Pfu DNA Ligase Discriminating oligo Common Probe Cy3 OH P cZip code GCAATTACGGATT CGCIIATTTACG 16S amplicon GCGIITAAATGCCGTTAATGCCTAA Perfect match Ligation product Cy3 cZip code CGCIIATTTACGGCAATTACGGATT A A 16S amplicon GCGIITAAATGCCGTTAATGCCTAA Detection on chip Ligation MIX DNA ‘universal’chip’ Zip 1 Spacer (polyA) Cy3 Spacer (polyA) cZip 3 SLIDE CGCIIATTTACGGCAATTACGGATT Ligationproduct Zip 3 Spacer (polyA) Spacer (polyA) Zip 4 B

More Related