CHAPTER 4
Download
1 / 88

DNA - PowerPoint PPT Presentation


  • 123 Views
  • Updated On :
  • Presentation posted in: General

2. CHAPTER 4 ???????DNA. DNA??????????. 1828?Friedrich Wohler ?????????????ammonium cyanate?????????,???????????????????????,???????????????????DNA??1869?Frederich Miescher ??????????????????????,??Oswald Avery?????????1944?,Avery??,????????????????????????,??????????????,Avery????????????????DNA,?

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


CHAPTER 4

DNA


DNA

  • 1828Friedrich Wohler ammonium cyanate

  • DNA1869Frederich Miescher Oswald Avery1944AveryAveryDNADNADNA

CHAPTER 4 DNA


  • James Watson Francis Crick 1953DNA1950Maurice WilkinsRaymond GoslingDNA X-Rosalind FranklinWilkinsGoslingWatson Crick1952Rosalind FranklinRaymond GoslingX-

  • WatsonCrickWilkins1962

CHAPTER 4 DNA


CHAPTER 4 DNA


  • Mycoplasma genitalium580,000DNA(bp)1,000DNA500

  • 250200300

  • DNAM. genitalium 550

CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • DNADNA (non-coding DNA)DNA

  • DNA(locusloci) (DNA)DNADNA(allele)

  • DNADNA

CHAPTER 4 DNA


  • DNA(intergenic DNA)DNADNADNA(intervening sequence)(intron)DNA(exon)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • mRNADNARNA(primary transcript) mRNA

CHAPTER 4 DNA


CHAPTER 4 DNA


DNADNA

  • RNAtRNA rRNA

CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • DNADNA20%65% DNA22%DNA(repeated sequences repetitive sequences) (tandem repeat) (interspersed sequences)DNA

CHAPTER 4 DNA


  • (consensus sequence)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • (pseudogene)

CHAPTER 4 DNA


  • 10,000DNArRNA tRNArRNA tRNA(moderately repetitive sequence)25% DNA

  • DNALINEsDNA(Long INterspersed Elements, LINE)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • 10% DNADNA(highly repetitive DNA) SINEDNA (Short INterspersed Elements, SINE)SINE300Alu(Alu element)

CHAPTER 4 DNA


DNADNA

  • LINEs SINEsDNA(tandem repeats)DNA (satellite DNA)TandemDNADNA8% DNADNA50%

  • (unequal crossing over) DNADNA

CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA(heterochromatin) (centromere)DNA(centromere sequence)

CHAPTER 4 DNA


DNAVNTR

  • DNADNADNA (mini-satellite) VNTR (Variable Number of Tandem Repeat)

  • VNTRVNTR

  • VNTR1,000DNA(DNA fingerprinting)

CHAPTER 4 DNA


CHAPTER 4 DNA


DNADNA

  • DNADNADNA (junk DNA)DNADNADNA (transposable element) ) DNA

CHAPTER 4 DNA


  • DNADNA

  • DNA (selfish DNA)

CHAPTER 4 DNA


  • DNADNADNA

CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


  • (palindrome) DNA(mirror-like palindrome) DNA

  • (inverted repeat)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA

  • GGATATCC(hairpin)

CHAPTER 4 DNA


(N)(stem and loop) DNA

CHAPTER 4 DNA


A-tracts DNA

  • DNAA (35)10 bpA-tractAs3-DNA (bent DNA) DNA

CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • 4,000DNADNA(supercoiled) DNA

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA(negative supercoils)DNA200DNA

  • DNA (gyrase) I (topoisomerase I) IV (topoisomerase IV)DNA

CHAPTER 4 DNA


  • IIVIVIIDNA50DNA

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNADNA (covalently closed circular DNAcccDNA)(open circle)

CHAPTER 4 DNA


DNA

  • DNA(linking number (L))[(twist, T)(writhewrithing number, W)linking number (L)twistwrithe (L=T+W)]

CHAPTER 4 DNA


  • DNAtopological(topoisomers) (topoisomerase)(type I topoisomerase) DNA(type II topoisomerase) [DNA (DNA gyrase)] DNADNA

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA (quinolone antibiotics) nalidixic acidnorfloxacin ciprofloxacinGyrAGyrADNADNA5'-novobiocin GyrBATP

CHAPTER 4 DNA


DNA

  • DNA(catenane) DNAIVDNADNA DNADNA IV (quinolone)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNADNARNADNADNAI

CHAPTER 4 DNA


  • DNAcccDNADNA DNA

  • DNA

CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • DNADNADNA(cruciform structure)(Z-DNA)(H-DNA)

    • DNA(RNA)

    • DNApurine

    • DNA12

CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • Watson CrickB-formB-DNAA-DNAZ-DNA

  • A-formB-form 11

  • A-DNARNAin vivo

CHAPTER 4 DNA


CHAPTER 4 DNA


  • Z-DNA12B-DNAZ-DNADNAZ-DNAGC GTDNA

    GCGCGCGCGCGCGCGTGTGTGTGTGTGT

    CGCGCGCGCGCGCGCACACACACACACA

    (GC)n(GC)n(GT)n(AC)n5' 3'

CHAPTER 4 DNA


  • Z-DNADNADNAGC-GT- Z-form Z-DNAB-DNA

  • DNAGCZ-form (GC)n Z-DNADNAZ-form

CHAPTER 4 DNA


  • Z-helixRNA (RNA editing enzyme, ADAR1)ADAR1adenosine deaminase (RNA) type Iadenosineinosine

  • H-DNA (purine) (pyrimidine)

    GGGGGGGGGGGGGGGAGAGAGAGAGAGA

    CCCCCCCCCCCCCCCCTCTCTCTCTCTCTC

    DNAH-DNA

CHAPTER 4 DNA


CHAPTER 4 DNA


  • H-DNA

  • H-DNA (adenine) (thymines) (guanine) (cytosines) (Hoogsteen base pairs H-DNA)C=G=C (H+)H-DNADNA

CHAPTER 4 DNA


DNA

  • DNA DNADNA(histone)

  • DNADNADNA(chromatin)Chromatin (nucleosome)200 bpDNA9H2AH2BH3H4 H1

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNADNA80 bp160 bp DNA40 bp (linker) (10100 bp) DNAH1

CHAPTER 4 DNA


  • DNADNA (micrococcal) 200 bp DNA 165 bpDNA146 bpDNA

CHAPTER 4 DNA


  • H2AH2B H3H4102135H1220H1

CHAPTER 4 DNA


CHAPTER 4 DNA


80N-20lysine (acetylation)

CHAPTER 4 DNA


DNA

  • DNAbeads on a string 6

  • 30(30 nanometer fiber)50 (300) (protein scaffold) (chromosome axis)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • (heterochromatin)

  • DNA10%(euchromatin)

CHAPTER 4 DNA


CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNADNADNADNADNA(chromatid)

CHAPTER 4 DNA


CHAPTER 4 DNA


DNA

  • DNADNA(melting) (denaturation)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA(melting temperature, Tm)DNA

CHAPTER 4 DNA


  • pHpHpHpHpH>11.3DNApHDNApHDNADNA

CHAPTER 4 DNA


  • DNAGCATGCGCATDNAGCATDNAGC(GC ratio) GC (% G+C)

CHAPTER 4 DNA


  • DNAATGC

CHAPTER 4 DNA


  • DNADNADNA(annealing) (renaturation)

  • DNADNATm2025CDNADNADNA (hybrid DNA)

CHAPTER 4 DNA


CHAPTER 4 DNA


  • DNA / RNA(hybridization) DNADNA

CHAPTER 4 DNA


ad
  • Login