1 / 51

DNA Rep & Protein Syn

DNA Rep & Protein Syn. 1928 – Griffith Transformation Experiment. 1941-Avery, McCarty, MacLeod. 1952-Hershey & Chase. 1952-Rosalind Franklin. 1953-Watson & Crick. Chromosomes, DNA, and Genes. DNA Structure. Deoxyribonucleic Acid Double Helix Made of nucleotides

tien
Download Presentation

DNA Rep & Protein Syn

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Rep & Protein Syn

  2. 1928 – Griffith Transformation Experiment

  3. 1941-Avery, McCarty, MacLeod

  4. 1952-Hershey & Chase

  5. 1952-Rosalind Franklin

  6. 1953-Watson & Crick

  7. Chromosomes, DNA, and Genes

  8. DNA Structure • Deoxyribonucleic Acid • Double Helix • Made of nucleotides • Pentose Sugar (deoxyribose) • Phosphate • Nitrogenous Base • A-T / C-G

  9. Nucleotide

  10. Nitrogenous Bases

  11. Base Pairing

  12. DNA is AntiParallel

  13. DNA is still AntiParallel

  14. How?

  15. Possible Models for DNA Replication

  16. Step 1

  17. Step 2

  18. DNA Replication Animation • http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork

  19. Think About It • If your DNA has 6 billion base pairs and generally there is one mistake made for every 100,000bp that are copied during replication, how many errors should result each time you copied your DNA? • How many errors result in reality? • Why?

  20. Protein Synthesis Overview

  21. RNA Structure • Ribonucleic Acid • Single Strand of nucleotides • Pentose Sugar (ribose) • Phosphate • Nitrogenous Base • A-U / C-G

  22. RNA Nucleotide

  23. 3 Types of RNA mRNA, tRNA, rRNA

  24. Protein Synthesis • Step 1 – Transcription • Step 2 – Translation

  25. Transcription • Definition • TATA Box • RNA Polymerase • DNA Terminator • 5’ Cap • Poly – A Tail

  26. TATA Box

  27. Transcription Animation • http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_2_.html

  28. mRNA Processing http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter16/animation_-_exon_shuffling.html

  29. Translation • Definition

  30. mRNA Codons • thedogbitthecatforfun • the dog bit the cat for fun • auguuucgcgggcuaagauaa

  31. tRNA

  32. Ribosome

  33. Codons

  34. Codons

  35. Translation Animation • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__how_translation_works.html

  36. Protein Folding

  37. Protein Processing • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter2/animation__protein_denaturation.html

  38. Gene Regulation • Repressible Operon – trp Operon • Inducible Operon – lac Operon

  39. trp Operon

  40. lac Operon

  41. cAMP & lac Operon

More Related