510 likes | 582 Views
DNA Rep & Protein Syn. 1928 – Griffith Transformation Experiment. 1941-Avery, McCarty, MacLeod. 1952-Hershey & Chase. 1952-Rosalind Franklin. 1953-Watson & Crick. Chromosomes, DNA, and Genes. DNA Structure. Deoxyribonucleic Acid Double Helix Made of nucleotides
E N D
DNA Structure • Deoxyribonucleic Acid • Double Helix • Made of nucleotides • Pentose Sugar (deoxyribose) • Phosphate • Nitrogenous Base • A-T / C-G
DNA Replication Animation • http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork
Think About It • If your DNA has 6 billion base pairs and generally there is one mistake made for every 100,000bp that are copied during replication, how many errors should result each time you copied your DNA? • How many errors result in reality? • Why?
RNA Structure • Ribonucleic Acid • Single Strand of nucleotides • Pentose Sugar (ribose) • Phosphate • Nitrogenous Base • A-U / C-G
3 Types of RNA mRNA, tRNA, rRNA
Protein Synthesis • Step 1 – Transcription • Step 2 – Translation
Transcription • Definition • TATA Box • RNA Polymerase • DNA Terminator • 5’ Cap • Poly – A Tail
Transcription Animation • http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_2_.html
mRNA Processing http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter16/animation_-_exon_shuffling.html
Translation • Definition
mRNA Codons • thedogbitthecatforfun • the dog bit the cat for fun • auguuucgcgggcuaagauaa
Translation Animation • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__how_translation_works.html
Protein Processing • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter2/animation__protein_denaturation.html
Gene Regulation • Repressible Operon – trp Operon • Inducible Operon – lac Operon