MOLEKULÁRNÍ TAXONOMIE
Download
1 / 41

Co je to molekulární taxonomie Zvláštnosti molekulárních znaků - PowerPoint PPT Presentation


  • 212 Views
  • Uploaded on

MOLEKULÁRNÍ TAXONOMIE Náplň kurzu. Co je to molekulární taxonomie Zvláštnosti molekulárních znaků Metody získávání experimentálních dat Metody zpracovávání dat Biologická interpretace Vaše dotazy a moje odpovědi. MOLEKULÁRNÍ TAXONOMIE Rozpis přednášek.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Co je to molekulární taxonomie Zvláštnosti molekulárních znaků' - shanna


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

MOLEKULÁRNÍ TAXONOMIE

Náplň kurzu

  • Co je to molekulární taxonomie

  • Zvláštnosti molekulárních znaků

  • Metody získávání experimentálních dat

  • Metody zpracovávání dat

  • Biologická interpretace

  • Vaše dotazy a moje odpovědi


MOLEKULÁRNÍ TAXONOMIE

Rozpis přednášek

  • 23.2. - Zahájení kurzu, taxonomie a molekulárně biologické znaky, metody sekvenace DNA

  • 2.3. - Databáze sekvencí a vyhledávání v nich (Marián Novotný)

  • 9.3. - Alignment sekvencí (Marián Novotný)

  • 16.3. - Získávání nesekvenčních molekulárních dat - multilokusové metody (RAPD, RFPL aj.), mikrosatelity, minisatelity, izoenzymová a alozymová analýza, imunologické metody

  • Praktikum 19.3.: Získávání sekvencí, alignment, odečet výsledků RAPD/RFLP

  • 23.3. - Evoluce sekvencí, odhad evoluční vzálenosti (distance)

  • 30.3. - Fylogenetické stromy I. - anatomie stromů, konstrukce stromů z genetických vzdáleností, algoritmy a hledání stromu s nejlepším skóre

  • 6.4. - Fylogenetické stromy II. Metoda maximální parsimonie, artefakty konstrukce stromů

  • 13.4. - Fylogenetické stromy III. - Metoda maximum likelihood, Bayéská metoda

  • 20.4. - Fylogenetické stromy IV. - Multigenové analýzy, určení věrohodnosti větvení stromů, nalezení kořene, testy topologie, datování pomocí molekulárních hodin

  • Praktikum 23.4.: Konstrukce stromů ze sekvencí DNA a z RAPD/RFLP dat

  • 27.4. - Identifikace jedinců, určování rodičovství, DNA barkóding

  • Praktikum 30.4.: Konstrukce stromů ze sekvencí proteinů

  • 4.5. - Vnitrodruhová fylogeneze, struktura populace a genový tok, fylogeografie, příklady

  • 11.5. - Speciace a hybridizace, kryptické druhy, příklady – odevzdání nepovinného eseje

  • Praktikum 15.5.: Různé testy, zpracování dat získaných analýzou mikrosatelitů

  • 18.5. - Prezentace studentů


MOLEKULÁRNÍ TAXONOMIE

Zkouška

Součásti zkoušky:

Písemná část (5 příkladů) – maximální zisk 10 bodů

Ústní část – maximální zisk 10 bodů

Nepovinný esej (2-3 strany) a jeho prezentace

(10 min.) – 4 body

Hodnocení:

11-13 bodů – dobře

14 – 17 bodů – velmi dobře

18 a více - výborně


MOLEKULÁRNÍ TAXONOMIE

Materiály ke studiu

  • WEB (Hampl): http://web.natur.cuni.cz/~vlada/moltax/

  • WEB (Flegr): http://web.natur.cuni.cz/~flegr/moltaxmater.php

  • KNIHY

  • Flegr J. Evoluční biologie, Academia 2005.

  • Kapitoly: IX.Evoluce sekvence DNA a XXIV. Molekulární fylogenetika

  • Avise J.C. Molecular markers, natural history and evolution. Sinauer Associates, Inc., 2004

  • Felsenstein J. Inferring phylogenies. Sinauer Associates, Inc., 2004

  • Nei M. & Kumar S. Molecular evolution and phylogenetics. Oxford Univ. Press, 2000


Molekulární taxonomie

Co to je za obor?

Taxonomie (systematika) využívající molekulárně biologické znaky.

Taxonomie

(systematika) = Snaží se katalogizovat biodiverzitu a uspořádat ji do systému obvykle hierarchicky řazených skupin.

Rozdíly v sekvenci DNA (potažmo proteinů).

Nepatří sem znaky na jiným molekulách (lipidy, polysacharidy, proteoglykany, terciární struktury proteinů aj.)


Taxonomie

Podle většinového názoru taxonomů je nejlepším přirozeným systémem organizmů ten, který odráží průběh jejich fylogeneze.

Fylogenetika – zabývá se vznikem a vývojem linií organizmů. Rekonstruje průběh kladogeneze (větvení), ale všímá si i anageneze vývoje vlastností organizmů v rámci linie.


Taxonomie

Existují různé názory na použitelnost znaků pro rekonstrukci fylogeneze:

Fenetika (podobnost) –

používá všechny znaky

Kladistika(důraz na příbuznost) –

používá výhradně synapomorfie

x1, y1, z1 = plesiomofie

x2 = synapomorfie pro BCD

y2 = autapomorfie pro B

z2 = homoplázie (konvergence) pro ED


taxonomie

Numerická taxonomie (60. minuleho století) – první pokus o objektivizaci taxonomie. Kladli důraz na použití velkého množství dat a vyvinuli matematické postupy, jak z nich vypočítat celkovou podobnost (nebo naopak odlišnost - distanci) mezi taxony. Je to tzv. fenetický přístup.

Kritizovánikladisty za to, že jim nevadí homoplázie.

Metody konstrukce stromů označované jako fenetické(založené na distancích) byly nebo jsou kladisty neprávem zavrhovány.

Kladistické metody (maximální parsimonie)se v praxi dostávajído podobných obtíží, nemají vodítko, jak rozeznat homoplázie a konflikty mezi znaky řeší nakonec podobně jako „fenetické“ metody.


Taxonomie

Na základě znalosti fylogeneze lze určit, které taxony vytvářet nesmíme, není však možné určit, které taxony vytvářet máme nebo musíme.


Taxonomie

  • Základním požadavkem na přirozený taxon je jeho monofyletičnost.

  • Monofyletický taxon je

    • takový, jehož členové si jsou vzájemně příbuzní více, než je kdokoli z nich příbuzný druhu mimo tento taxon

    • jinak řečeno, takový, který zahrnuje všechny potomky jednoho předka

Monofyletický

(přípustný pro evoluční taxonomy i kladisty)

Parafyletický

(přípustný pro evoluční taxonomy)

Polyfyletický

(nepřípustný)


Molekulární taxonomie

Co to je za obor?

Taxonomie (systematika) využívající molekulárně biologické znaky.

Taxonomie

(systematika) = Snaží se katalogizovat biodiverzitu a uspořádat ji do systému obvykle hierarchicky řazených skupin.

Rozdíly v sekvenci DNA (potažmo proteinů).

Nepatří sem znaky na jiným molekulách (lipidy, polysacharidy, proteoglykany, terciární struktury proteinů aj.)


Výhody molekulárních znaků

1. Jsou genetické

Víme jak se dědí, nezávisí na prostředí ani genetickém pozadí. Je to právě ta úroveň kde vznikají evoluční novinky – mutace v DNA.

2. Je jich obrovské množství: Velikost genomů se pohybuje od 0,5*106 – 600*109. Lidský genom obsahuje přes 3 miliardy párů bazí. Odhaduje se, že lidé se mezi sebou liší v 0,1% tj 3 miliónech bazí.


Výhody molekulárních znaků

3. Jsou použitelné od těch nejvzdálenějších srovnání …

ACCTGGATGCACTTGAATGCACTTCGATGGACTTCAAGGG


Výhody molekulárních znaků

3. … až po porovnávání jedinců téhož druhu


Výhody molekulárních znaků

4. Jsou selekčně neutrální

Podle nich rozlišíme homologii a homoplázii

Sup africký

Kondor andský

Sup africký


Výhody molekulárních znaků

5. Dají se jednoznačně popsat

6. Jsou nezávislé

7. Jsou lépe vážitelné

8. Lépe se kvantifikuje stupeň nejistoty

ACCTGGATGCACTTGAATGCACTTCGATGGACTTCAAGGG

2

1


Výhody molekulárních znaků

  • Molekulární hodiny

  • Polarita evolučních změn

  • Informace o dřívější struktuře populace


Nevýhody molekulárních znaků

  • Neposkytují informaci o anagenezi

  • Cena

  • Někdy destruktivní charakter


Neutrální teorie evoluce

  • „…Naprostá většina substitucí na úrovni DNA vznikla náhodnou fixací (pomocí genetického driftu) selektivně neutrálních (= stejně dobrých) mutantů…“ (Kimura 1991)

  • Aby bylo jasno:

  • Neutrální teorie netvrdí, že většina genů je postradatelná, ale tvrdí, že většina forem (alel) téhož genu je funkčně stejně dobrá.

  • Neutrální teorie netvrdí, že jsou mutace se škodlivým efektem, které jsou eliminovány přírodním výběrem, ale tvrdí že takových mutací je menšina.

  • Neutrální teorie nezavrhuje darwinistickou adaptivní evoluci poháněnou přírodním výběrem, ale tvrdí, že většina mutací je pro přírodní výběr „neviditelná“ a k adaptivní evoluci nepřispívá.

  • Neutrální teorie nejlépe vysvětluje, kde se bere tolik polymorfismu (rozdílů) v DNA.


Genetický draft – svezení se

Neutrální mutace, které se vyskytují poblíž výhodné mutace se v populaci rychle fixují společně s výhodnou mutací.


závěr

  • Pro tvorbu přirozeného systému je nezbytné znát fylogenezi organizmů

  • Je dovoleno vytvářet jen monofyletické případně parafyletické taxony

  • Molekulární znaky mají spoustu důležitých výhod

  • Molekulární znaky jsou vhodné pro studium studium kladogeneze nikoli anageneze

  • Molekulární znaky vznikají převážně neutrální evolucí a k jejich fixací přispívá genetický draft



Sangerova metoda - I

PCR Amplifikace

Vložení do plazmidu

Sekvenace


Sangerova metoda - II

G

G

G

G

Kapilární elektroforéza


Nextgenerationsequencing

Díky masivní paralelizaci (najednou sekvenují milióny templátů ) dokáží v krátkém čase vygenerovat obrovské množství sekvencí. Cena za 1 bázi podstatně klesá.

=

SOLiD™


454 – emulzní PCR


454 – destička


454 – chemie pyrosekvenování


454 – výstup


454 – to je ten stroj

Jonathan M. Rothberg


Illumina

http://seqanswers.com/forums/showthread.php?t=21


Illumina

http://seqanswers.com/forums/showthread.php?t=21


Illumina

http://seqanswers.com/forums/showthread.php?t=21


Illumina

http://seqanswers.com/forums/showthread.php?t=21


SOLiD


SOLiD


SOLiD


SOLiD


SOLiD


závěr

Porovnání některých parametrů technologií sekvenace DNA

Metody jsou různě vhodné k různým účelům. Na „de novo“ sekvenování je nejvhodnější Sanger a 454. SOLiD a Illumina je lepší na re-sekvenování. Dobré je metody kombinovat.

'3rd generation' ('next-next-generation') sequencing klepe na dveře – systémy založené na jedné molekuly – společnosti VisiGen and Helicos.



ad