'Suffix trees' presentation slideshows

Bioinformatics PhD. Course

Bioinformatics PhD. Course. 1. Biological introduction . 2. Comparison of short sequences ( up to 10.000bps) . Dot Matrix Pairwise align. Multiple align. Hash alg. . 3. Comparison of large sequences ( more that 10.000bps) .

1.26k views • 109 slides

Comparison of large sequences

1.16k views • 106 slides

Introduction on biological sequence indexing, searching and text mining

Introduction on biological sequence indexing, searching and text mining. ??????????????? ???. Outlines. Introduction on sequence searching Patten Searching -Suffix tree BLAST Introduction on text mining -Case study. Bioinformatics topics.

975 views • 77 slides

Suffix trees

Suffix trees. Trie. A tree representing a set of strings. c. a. { aeef ad bbfe bbfg c }. b. e. b. d. e. f. f. e. g. Trie (Cont). Assume no string is a prefix of another. c. 1) Each edge is labeled by a letter,

882 views • 71 slides

Suffix Trees and their applications

Suffix Trees and their applications. Amit Metodi and Tali Weinberger. Seminar 2012/1. Outline. Introduction to Suffix Trees Trie and Compressed Trie Suffix Tree Trivial Construction Algorithm O(N^2) Exact string matching Generalized suffix tree Applications. Trie.

918 views • 70 slides

Text Indexing and Dictionary Matching with One Error

Text Indexing and Dictionary Matching with One Error. Amir, A., KeseIman, D., Landau, G., M. and etc, Journal of Algorithm, 37, 2000, pp. 309-325. Adviser: R. C. T. Lee Speaker: C. W. Cheng. Problem Definition. The Indexing Problem ?

796 views • 69 slides

Bioinformatics PhD. Course

Bioinformatics PhD. Course. Summary (approximate). 1. Biological introduction. 2. Comparison of short sequences (<10.000 bps). 3 Comparison of large sequences (up to 250 000 000). 4 Sequence assembly. 5 Efficient data search structures and algorithms. 6 Proteins.

738 views • 62 slides

Combinational Pattern Matching

Combinational Pattern Matching. Shashank Kadaveru. Introduction. In Motif Finding problem, no particular pattern is given to search for. We infer it from the sample. In Combinational Pattern Matching, we look for exact or appropriate occurrences of given patterns in a long text. .

618 views • 45 slides

Inferring Strings from Suffix Trees and Links on a Binary Alphabet

Inferring Strings from Suffix Trees and Links on a Binary Alphabet. Tomohiro I , Shunsuke Inenaga , Hideo Bannai , Masayuki Takeda Kyushu University, Japan. Outline. Reverse Problems on String Data Structures Suffix Tree, Suffix Links Reverse Problem on Suffix Trees Efficient Solution

577 views • 40 slides

GTCAG ATGAGCAAAGTAGACACTCCAGTAACGCG GTGAGTACATTAA

intron. exon. exon. intron. intergene. exon. intergene. Find Gene Structures in DNA. First Exon State. Intron State. Intergene State. GTCAG ATGAGCAAAGTAGACACTCCAGTAACGCG GTGAGTACATTAA. Hidden Markov Model for Gene Finding. Intron, Exon, Intergenic states

449 views • 34 slides

SUFFIX TREES

17 dicembre 2003. Luca Bortolussi. SUFFIX TREES. From exact to approximate string matching. An introduction to string matching. String matching is an important branch of algorithmica, and it has applications in many fields, as: Text searching Molecular biology Data compression and so on….

425 views • 27 slides

Pattern and string matching tools

Pattern and string matching tools. Biology 162 Computational Genetics Todd Vision 9 Sep 2004. Some more pattern and string matching tools. Simple signatures Logos Position-specific Scoring Matrices PSI-BLAST Regular expressions Suffix trees. Sequence logos.

457 views • 27 slides

Suffix Trees

430 views • 25 slides

Linear-Time Computation of Similarity Measures for Sequential Data

Linear-Time Computation of Similarity Measures for Sequential Data. Presenter : Cheng-Feng Weng Authors : Konrad Rieck and Pavel Laskov 2008/09/11. ML.26 (2008). Outline. Introduction Motivation Objective Methods Experimental results Conclusion Comments. Introduction.

313 views • 24 slides

417 views • 22 slides

Suffix Trees

358 views • 21 slides

Fast Approximate Database Searching of Polypeptide Structures

Efficient Algorithms Group Prof. Ernst W. Mayr Technical University of Munich. Fast Approximate Database Searching of Polypeptide Structures. Hanjo Taeubig Arno Buchner Jan Griebsch. German Conference on Bioinformatics October 4th, 2004. Structure. motivation & problem definition

303 views • 21 slides

Gene-Boosted Assembly of a Novel Bacterial Genome from Very Short Reads

Harry Presman. Gene-Boosted Assembly of a Novel Bacterial Genome from Very Short Reads. Overview. Motivation Assembly Results Advantages/Limitations. Motivation. Next-gen sequencers produce short read-lengths Useful for polymorphism discovery Difficult to assemble whole genomes

304 views • 16 slides

Suffix Array: Data structures and applications

Suffix Array: Data structures and applications. Zhifeng Liu School of Computer Science, Univ. of Waterloo Dec. 06, 2004. Outline. Introduction Suffix array and enhanced suffix array An example - Is P a substring of S ? Conclusions References. Introduction Why suffix array?.

350 views • 14 slides

Suffix Trees

Suffix Trees. Specialized form of keyword trees New ideas preprocess text T, not pattern P O(m) preprocess time O(n+k) search time k is number of occurrences of P in T edges can have string labels. p. t. o. o. e. p. o. t. e. o. 4. 1. 2. 3. Keyword Tree.

217 views • 10 slides