'Biological data' presentation slideshows

Dave Clements GMOD Help Desk US National Evolutionary Synthesis Center (NESCent)

Database Tools for Biologists. Pre-conference workshop. Dave Clements GMOD Help Desk US National Evolutionary Synthesis Center (NESCent) clements@nescent.org. Sponsored by. Bioinformatics Australia 2009 28 October 2009, 2-6 pm. This talk is available in two formats. PowerPoint

888 views • 74 slides

1.19k views • 72 slides

Advanced Bioinformatics (MB480/580)

Advanced Bioinformatics (MB480/580). >Sulfolobus virus 1 complete genome 15465 bp. TTCGCCCGCTTACCGACGTACTTCGGTGAGGAACCGGTAACGGAGTTAG TACGCCCATAAGTTGAAACATTATCTCGTTTCGAAAGGAGGAAGAGGAA GATATACTGAGAGTCCTACGCGTTAGTTCAGGTCAGACAAGAGAGAACG AAATCAATTCTGAAACAATTATTTGACCATGGTAAGGAACATGAAGATG

634 views • 49 slides

Diseases

Genes. Diseases. Diseases. Diseases. Physiology. Diseases. Physiology. Genes. Genes. Anatomy. Diseases. Physiology. Anatomy. Diseases. Physiology. Anatomy. Diseases. Physiology. Anatomy. Diseases. Physiology. Anatomy. Diseases. Physiology. Anatomy. Diseases. Anatomy.

613 views • 49 slides

Introduction to Bioinformatics

Introduction to Bioinformatics. Lecturer: Prof. Yael Mandel-Gutfreund Teaching Assistance: Rachelly Normand Alona Rabner Leon Anavi. Course web site : http://webcourse.cs.technion.ac.il/236523. What is Bioinformatics?. Course Objectives.

725 views • 36 slides

Tactical Formalization of Linked Open Data

Tactical Formalization of Linked Open Data. Michel Dumontier , Ph.D. Associate Professor of Medicine (Biomedical Informatics) Stanford University. Linked Open Data provides an incredibly dynamic, rapidly growing set of interlinked resources.

527 views • 27 slides

LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D. 1.932 / xhjkwon@hotmail

389 views • 23 slides

Outline

Globodera ellingtonae : a new Potato cyst nematode Species Inga A. Zasada AND Wendy Phillips USDA-ARS horticultural Crops Research Laboratory, Corvallis, OR Russell E. Ingham Oregon State University, Corvallis, OR. Outline. Globodera in the United States

412 views • 23 slides

The use of Ontology in Organising and Managing Protein Family Resources

341 views • 23 slides

What I want to be when I grow up!

5. 4. 3. 2. 1. What I want to be when I grow up!. By: Jake Dexter. Zoologist. Job Outlook G row by 7 percent from 2010 to 2020. Jump from 19,800-21,300 (+1,500). Salary. Median salary of 2010 was $57,430 L owest 10% earned less than $35,660 Highest 10% earned more than $93,450.

781 views • 21 slides

(near term) Develop Database Requirements to Yield Schema and Interfaces

(near term) Develop Database Requirements to Yield Schema and Interfaces MoBIoS: Database Management for Data in Metric Spaces Daniel P. Miranker Univ. of Texas. What we know for sure: Exploit Commodity Architecture. External Data/DB Sources. Web App Server. Curating New Content.

329 views • 20 slides

What is the real secret to the success of DIMACS?

What is the real secret to the success of DIMACS?. Talented leadership. Talented leadership Robustly funded. Talented leadership Robustly funded Ably administered. Talented leadership Robustly funded Ably administered Nimble and opportunistic. Talented leadership Robustly funded

212 views • 13 slides

Introduction to other web-based resources

Introduction to other web-based resources. What? Where? and How? of Bioinformatics June 3, 2009. Protein seq. DNA seq. Protein structure. Protein function. Applications. Bioinformatics.

227 views • 12 slides

Collaborative Expedition Workshop September 18, 2007 Brand Niemann, US EPA

Organizing Future Expeditions: Improving Citizen Services from the Bottom-Up: Open Communities, Information Sharing, and Technology. Collaborative Expedition Workshop September 18, 2007 Brand Niemann, US EPA Co-chair Federal SICoP and SOA CoP. Background.

458 views • 10 slides

256 views • 9 slides

183 views • 9 slides

Report on the Working Group on Data Management

1 8 -1 9 January 2007 NEAR-GOOS CC11 Bangkok, Thailand. Report on the Working Group on Data Management. Takashi Yoshida JMA. Introduction At CC9, it was decide to establish a Working Group on NEAR-GOOS Data Management

192 views • 7 slides

GMOD Project Slides

223 views • 6 slides

Upper Delaware American eel Mari-Beth DeLucia, The Nature Conservancy TNC & USGS 2006-2008,

Upper Delaware American eel Mari-Beth DeLucia, The Nature Conservancy TNC & USGS 2006-2008, Yellow eel, abundance, distribution & biological data (weight & length) Location Tributaries to Upper Delaware River: NY, NJ, PA. 330 miles from bay.

167 views • 5 slides

2006-WS on FishFrame Acoustics

2006-WS on FishFrame Acoustics. Extraction of methodology descriptions. Teunis Jansen Danish Institute for Fisheries Research. Regions and combination of trawls. Nederland:

152 views • 4 slides