'Average linkage' presentation slideshows

Weighted Clustering

830 views • 64 slides

DNA Sequencing

717 views • 48 slides

Chapter 12: Cluster analysis and segmentation of customers

Chapter 12: Cluster analysis and segmentation of customers . Commercial applications. A chain of radio-stores uses cluster analysis for identifying three different customer types with varying needs.

1.48k views • 45 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Decoding: the CYK algorithm. Given x = x 1 ....x N , and a SCFG G, Find the most likely parse of x

536 views • 44 slides

Sequence Clustering

Sequence Clustering. Reducing Search S pace in Protein and DNA /RNA S equence A nalysis Denis Kaznadzey, Prokaryotic Super Program. MGM Workshop May 14, 2012. Sequence Clustering Outline. Classification of Sequences General Problem of Clustering Distance Measures

691 views • 43 slides

Sequence Clustering

Sequence Clustering. Reducing Search S pace in Protein and DNA /RNA S equence A nalysis Denis Kaznadzey, Prokaryotic Super Program. MGM Workshop January 30, 2011. Sequence Clustering Outline. Classification of Sequences General Problem of Clustering Distance Measures

649 views • 43 slides

Dendrograms for Data Mining

Eamonn Keogh. Dendrograms for Data Mining. What is Clustering?. Also called unsupervised learning , sometimes called classification by statisticians and sorting by psychologists and segmentation by people in marketing.

525 views • 42 slides

Phylogeny Tree Reconstruction

1. 4. 3. 5. 2. 5. 2. 3. 1. 4. Phylogeny Tree Reconstruction. Inferring Phylogenies. Trees can be inferred by several criteria: Morphology of the organisms Sequence comparison Example: Orc: A C A G T G A C G CCCC AAA C G T Elf: A C A G T G A C G C T A C AAA C G T

486 views • 40 slides

Evaluation of Clustering Techniques on DMOZ Data

583 views • 36 slides

Cluster Analysis ( ?? ?? )

Cluster Analysis ( ?? ?? ). Cluster Analysis ?. (1) Primary Objective : ??? ??? ???? ??? ?? , ??? ??? ?? ???? ????? ???? ???? ???? ? (2) Basic Principle

737 views • 31 slides

Clustering

Clustering. Log 2 transformation Row centering and normalization Filtering. Clustering Preliminaries. Log 2 -transformation makes sure that the noise is independent of the mean and similar differences have the same meaning along the dynamic range of the values.

409 views • 30 slides

Clustering

Clustering. Log 2 transformation Row centering and normalization Filtering. Clustering Preliminaries. Log 2 -transformation makes sure that the noise is independent of the mean and similar differences have the same meaning along the dynamic range of the values.

429 views • 30 slides

Grigory Yaroslavtsev Indiana University (Bloomington) grigory /blog

294 views • 29 slides

Microarray Data Analysis

Microarray Data Analysis. Data preprocessing and visualization Supervised learning Machine learning approaches Unsupervised learning Clustering and pattern detection Gene regulatory regions predictions based co-regulated genes

357 views • 24 slides

Clustering

Clustering. Patrice Koehl Department of Biological Sciences National University of Singapore. http://www.cs.ucdavis.edu/~koehl/Teaching/BL5229 dbskoehl@nus.edu.sg. Clustering is a hard problem. Many possibilities; What is best clustering ?. Clustering is a hard problem. 2 clusters: easy.

245 views • 24 slides

Clustering

Clustering. Patrice Koehl Department of Biological Sciences National University of Singapore. http://www.cs.ucdavis.edu/~koehl/Teaching/BL5229 dbskoehl@nus.edu.sg. Clustering is a hard problem. Many possibilities; What is best clustering ?. Clustering is a hard problem. 2 clusters: easy.

244 views • 24 slides

Metrics, Algorithms & Follow-ups

296 views • 21 slides

Hierarchical Clustering

Hierarchical Clustering. Two Types of Clustering. Partitional algorithms: Construct various partitions and then evaluate them by some criterion Hierarchical algorithms: Create a hierarchical decomposition of the set of objects using some criterion. Partitional. Hierarchical.

290 views • 17 slides

Multivariate Data Analysis Chapter 9 - Cluster Analysis

Multivariate Data Analysis Chapter 9 - Cluster Analysis. MIS 6093 Statistical Method Instructor: Dr. Ahmad Syamil. Chapter 9. What Is Cluster Analysis? How Does Cluster Analysis Work? Measuring Similarity Forming Clusters Determining the Number of Clusters in the Final Solution .

848 views • 10 slides