Development of snp multiplex assays for disease resistance genes in tomato
This presentation is the property of its rightful owner.
Sponsored Links
1 / 17

Development of SNP Multiplex Assays for Disease Resistance Genes in Tomato PowerPoint PPT Presentation


  • 165 Views
  • Uploaded on
  • Presentation posted in: General

Development of SNP Multiplex Assays for Disease Resistance Genes in Tomato. Ainong Shi and Richard Vierling Indiana Crop Improvement Association (Purdue University). Richard Grazzini GardenGenetics LLC. Genetic resistance is the primary method of controlling plant diseases

Download Presentation

Development of SNP Multiplex Assays for Disease Resistance Genes in Tomato

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Development of snp multiplex assays for disease resistance genes in tomato

Development of SNP Multiplex Assays for Disease Resistance Genes in Tomato

Ainong Shi and Richard Vierling

Indiana Crop Improvement Association

(Purdue University)

Richard Grazzini

GardenGenetics LLC


Development of snp multiplex assays for disease resistance genes in tomato

  • Genetic resistance is the primary method of controlling plant diseases

  • Marker assisted selection (MAS) has become important and useful in the selection of disease resistance genes

  • Single nucleotide polymorphism (SNP), because of its abundance and high-throughput scoring potential is becoming a powerful tool in genome mapping, association studies, diversity analysis, and tagging of important genes in plant genomics


Development of snp multiplex assays for disease resistance genes in tomato

Molecular Marker Evolution

Linked maker

Sequence-derived SNP

Gene sequence-derived SNP

(I-2 locus)

Gene-specific marker

Allele sequence-derived SNP

(I-2 and i-2)

Allele-specific marker

Molecular Assisted Selection

Single gene

Multiple genes in one disease

QTLs

Multiple genes in multiple diseases


Development of snp multiplex assays for disease resistance genes in tomato

Single Nucleotide Polymorphism (SNP)

An example for Mi

Motella/LA2823MiAAGTAGACGAGGTTAGTAAAAT

Mogeor/LA3471MiAAGTAGACGAGGTTAGTAAAAT

NY07-464miAAGTAGACGACGTTAGTAAAAT

LA3130miAAGTAGACGACGTTAGTAAAAT

Motella

Mogeor

G

G

NY07-464

LA3130

C

C


Development of snp multiplex assays for disease resistance genes in tomato

Five Tomato Diseases

A

B

C

E

D

A.Fusarium wilt (Fusarium oxysporum f. sp. Lycopersici) (image from apsnet)

B.Verticillium wilt (V. dahliae and V. albo-atrum) (image from Cornell)

C.Root-knot nematode (Meloidogyne incognita, M. javanica) (image from NCSU)

D.Tomato mosaic virus (ToMV) (image from apsnet)

E.Tomato spotted wilt virus (TSWV) (image from NCSU)


Development of snp multiplex assays for disease resistance genes in tomato

Objective

  • To identify SNP markers for I-2of Fusarium wilt resistance,

  • Mi of root-knot nematode resistance,

  • Sw-5of TSWV resistance,

  • Tm-2of ToMV resistance, and

  • Ve of Verticillium wilt resistance

  • To develop a multiplex SNP assay for marker assisted selection (MAS) of the five genes


Development of snp multiplex assays for disease resistance genes in tomato

Develop Allele-specific SNP Marker for Sw-5

(for example)

  • Sw-5 is the most broadly deployed TSWV resistance gene utilized in tomato breeding because of its durability and stable resistance (Boiteux and Giordano, 1992; Stevens et al., 1992, 1994, 1995).

  • Sw-5 gene has been cloned and its sequence was deposited in GenBank with the accession AY007366.

Sw-5 – AY007366


Development of snp multiplex assays for disease resistance genes in tomato

Procedure for development of Sw-5 specific SNP markers

Sw-5 Gene Sequence

Primer Design

PCR

Sequencing PCR Products

Multiple Sequence Alignment

SNP Discovery

SNP Validation

SNP Genotyping


Development of snp multiplex assays for disease resistance genes in tomato

Sw-5: AY007366

Tool: Primer-BLAST

Primer design

Sw5-f1AACCACTAGGGGCAGTCCTT

Sw5-r1CTCACTATGTGGCTGCTCCA

(TGGAGCAGCCACATAGTGAG)

PCR

PCR Product

Sequencing


Development of snp multiplex assays for disease resistance genes in tomato

Multiple Sequence Alignment

- Tool - BioEdit


Development of snp multiplex assays for disease resistance genes in tomato

SNP Discovery

* Sw-5 consisted of Sw-a and Sw-b. Sw5-a is located at 20824-24561 base and Sw5-b at 29513-33253 base of the GenBank accession AY0073366 that was cloned from the tomato cultivar “Stevens” (Folkertsma et al 1999). Sw-b is the functional allele for conferring resistance to TSWV (Spassova et al., 2001).

‘W’ = ‘A/T’, ‘Y’ = ‘C/T’, and ‘R’ = ‘A/G’


Development of snp multiplex assays for disease resistance genes in tomato

SNP Validation and Genotyping by Sequenom


Development of snp multiplex assays for disease resistance genes in tomato

Summary

One 9-SNP multiplex assay was developed:

one for I-2, one for Mi, two for Sw-5,

two for Tm-2 locus, and three for Ve1


Development of snp multiplex assays for disease resistance genes in tomato

Further Research

More SNPs,

more genes,

more diseases

Linked SNP

Single gene

Gene sequence-derived SNP

Multiple genes in one disease

QTLs

Allele sequence-derived SNP

Multiple genes in multiple diseases


Development of snp multiplex assays for disease resistance genes in tomato

ACKNOWLEDGEMENTS

Cornell University:

G. Moriarty, M. Glos and M. Jahn

Restoring our Seed:

C. R. Lawn

TGRC, University of California, Davis:

Roger Chetelat, Sheh May Tam


Development of snp multiplex assays for disease resistance genes in tomato

Richard Grazzini

GardenGenetics LLC

Email: [email protected]

Web: http://gardengenetics.com

Richard Vierling

Indiana Crop Improvement Association

(Purdue University)

Email: [email protected]

Web: http://www.indianacrop.org

Ainong Shi

Indiana Crop Improvement Association

(Purdue University)

EmaiL: [email protected]

Web: http://web.ics.purdue.edu/~shia


Development of snp multiplex assays for disease resistance genes in tomato

Thank you!


  • Login