Chapter 9 proteins and their synthesis
This presentation is the property of its rightful owner.
Sponsored Links
1 / 58

Chapter 9 Proteins and Their Synthesis PowerPoint PPT Presentation


  • 39 Views
  • Uploaded on
  • Presentation posted in: General

Chapter 9 Proteins and Their Synthesis. Green Fluorescent Protein drawn in cartoon style with fluorophore highlighted as ball-and-stick; one wholly-reproduced protein, and cutaway version to show the fluorophore. Review Central Dogma. 5 ’ ATG GAC CAG TCG GTT TAA GCT 3 ’

Download Presentation

Chapter 9 Proteins and Their Synthesis

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Chapter 9 proteins and their synthesis

Chapter 9 Proteins and Their Synthesis

Green Fluorescent Protein drawn in cartoon style with fluorophore highlighted as ball-and-stick; one wholly-reproduced protein, and cutaway version to show the fluorophore.


Review central dogma

ReviewCentral Dogma

5’ ATG GAC CAG TCG GTT TAA GCT 3’

3’ TAC CTG GTC AGC CAA ATT CGT 5’

DNA

RNA

Protein

transcription

5’AUG GAC CAG UCG GUU UAA GCU 3’

translation

aa - aa - aa - aa - aa - aa - aa


Chapter 9 proteins and their synthesis

Protein Structure

via condensation


Chapter 9 proteins and their synthesis

Protein Structure

Primary Structure


Chapter 9 proteins and their synthesis

Protein folding is dependent on the amino acid R groups

R

H2N C COOH

H

General Structure

There are 20 amino acids.

Their properties are determined by the R group.


Chapter 9 proteins and their synthesis

There are 20 amino acids.

  • Nonpolar or hydrophobic (9)

  • Polar (hydrophillic), but uncharged (6)

  • Polar (hydrophillic), but charged (5)


Chapter 9 proteins and their synthesis

Nonpolar

(Hydrophobic)

ring


Chapter 9 proteins and their synthesis

sulfur


Chapter 9 proteins and their synthesis

Protein Structure

Primary Structure


Chapter 9 proteins and their synthesis

Protein Structure

Two major types of Secondary Structure

α Helix

β Sheet


Chapter 9 proteins and their synthesis

Protein Structure


How do we get from dna to primary protein structure

How do we get from DNA to Primary protein structure ?

5’ ATG GAC CAG TCG GTT TAA GCT 3’

3’ TAC CTG GTC AGC CAA ATT CGT 5’

DNA

RNA

Protein

transcription

5’AUG GAC CAG UCG GUU UAA GCU 3’

translation

aa - aa - aa - aa - aa - aa - aa


Chapter 9 proteins and their synthesis

DNA (mRNA) is read in Triplets

-Codon – Group of 3 DNA bases codes for a specific amino acid

Ex. ATG = methionine

-This means the code is degenerate – more than one codon can specify one amino acid


Chapter 9 proteins and their synthesis

The Genetic Code - Nonoverlapping


Chapter 9 proteins and their synthesis

Key To The Genetic Code

Groups of 3 mRNA bases (codons) code for specific amino acids

5’ CCAACCGGG 3’

CCA-ACC-GGG

Pro-Thr-Gly


Chapter 9 proteins and their synthesis

The Genetic Code – Stop Codons

UGA

UAA

UAG


Chapter 9 proteins and their synthesis

Proteins and Genes are Colinear

Mutations in DNA show specific corresponding changes in the protein

Genes are converted to proteins in a linear fashion


Chapter 9 proteins and their synthesis

Key To The Genetic Code

CCG UGG AGA GAC UAA

Pro – Trp – Arg –Asp - Stop

CCG UCG AGA GAC UAA

Pro – Ser – Arg –Asp - Stop

CCG UGG CGA GAC UAA

Pro – Trp – Arg –Asp - Stop

CCG UGG AGA GAC UAA

Pro – Stop

CCG UGG AGA CGA CUA

Pro – Trp – Arg –Arg - Leu


Chapter 9 proteins and their synthesis

The Genetic Code - Mutations

  • 4 Types of Mutations

  • Silent mutations

  • Missense mutations

  • Nonsense mutations

  • Frameshift mutations


Chapter 9 proteins and their synthesis

The Genetic Code

mRNA has 3 potential “reading frames”

5’ CUUACAGUUUAUUGAUACGGAGAAGG 3’

3’ GAAUGUCAAAUAACUAUGCCUCUUCC 5’

5’CUU ACA GUU UAU UGA UAC GGA GAA GG 3’

3’GAA UGU CAA AUA ACU AUG CCU CUU CC 5’

5’ C UUA CAG UUU AUU GAU ACG GAG AAG G 3’

3’ G AAU GUC AAA UAA CUA UGC CUC UUC C 5’

5’ CU UAC AGU UUA UUG AUA CGG AGA AGG 3’

3’ GA AUG UCA AAU AAC UAU GCC UCU UCC 5’

Stop

UAA

UGA

UAG


Chapter 9 proteins and their synthesis

The Genetic Code

mRNA has 3 potential reading frames

5’ CUUACAGUUUAUUGAUACGGAGAAGG 3’

3’ GAAUGUCAAAUAACUAUGCCUCUUCC 5’

5’ CUU ACA GUU UAU UGA UAC GGA GAA GG 3’

3’ GAA UGU CAA AUA ACU AUG CCU CUU CC 5’

5’ C UUA CAG UUU AUU GAU ACG GAG AAG G 3’

3’ G AAU GUC AAA UAA CUA UGC CUC UUC C 5’

5’ CU UAC AGU UUA UUG AUA CGG AGA AGG 3’

3’ GA AUG UCA AAU AAC UAU GCC UCU UCC 5’

Stop

UAA

UGA

UAG


Chapter 9 proteins and their synthesis

Review - RNA

mRNA- messenger RNA

tRNA- transfer RNA

rRNA- Ribosomal RNA


Chapter 9 proteins and their synthesis

tRNA-The adapter


Chapter 9 proteins and their synthesis

tRNA-The adapter

  • -tRNA functions as the adapter between amino acids and the RNA template

  • -tRNAs are structurally similar except in two regions

    • Amino acid attachment site

    • Anticodon


Chapter 9 proteins and their synthesis

tRNA-The anticodon

  • The tRNA anticodon

  • 3 base sequence

  • Complementary to the codon

  • Base pairing between the mRNA and the tRNA

  • Oriented and written in the 3’ to 5’ direction

tRNA

mRNA

3’ CUG 5’

5’ GAC 3’

Aspartic Acid


Chapter 9 proteins and their synthesis

Aminoacyl-tRNA synthetase

The enzyme responsible for joining an amino acid to its corresponding tRNA

20 tRNA synthetases – 1 for each amino acid


Chapter 9 proteins and their synthesis

Wobble

Allows one tRNA to recognize multiple codons

Occurs in the 3rd nucleotide of a codon


Chapter 9 proteins and their synthesis

Wobble – A new set pairing of rules

I = Inosine: A rare base found in tRNA


Chapter 9 proteins and their synthesis

Wobble – A new set pairing of rules

Isoaccepting tRNAs: tRNAs that accept the same amino acid but are transcribed from different genes


Chapter 9 proteins and their synthesis

Wobble Problem

What anticodon would you predict for a tRNA species carrying isoleucine?


Chapter 9 proteins and their synthesis

Ribosomes – General characteristics

  • Come together with tRNA and mRNA to create protein

  • Ribosome consist of one small and one large subunit

  • In prokaryotes, 30S and 50S subunits form a 70S particle

  • In Eukaryotes, 40S and 60S subunits form an 80S particle

  • Each subunit is composed of 1 to 3 types of rRNA and up to 49 proteins


Chapter 9 proteins and their synthesis

Ribosomes – General characteristics


Chapter 9 proteins and their synthesis

Ribosomes – General characteristics

  • rRNA folds up by intramolecular base pairing


Chapter 9 proteins and their synthesis

Ribosomes – General characteristics


Chapter 9 proteins and their synthesis

Translation

Synthesizing Protein


Chapter 9 proteins and their synthesis

An overview


Chapter 9 proteins and their synthesis

Translation Initiation - Prokaryotes

Translation begins at an AUG codon – Methionine

Requires a special “initiator” tRNA charged with Met – tRNAMeti

This involves the addition of a formyl group to methionine while it is attached to the initiator


Chapter 9 proteins and their synthesis

Shine-Dalgarno Sequence

mRNA only associates with unbound 30S subunit


Chapter 9 proteins and their synthesis

Translation Initiation – ProkaryotesInitiation Factors

3 initiation factor proteins are required for the start of translation in prokaryotes

IF1 – Binds to 30S subunit as part of the complete initiation complex. Could be involved in stability

IF2 – Binds to charged initiator tRNA and insures that other tRNAS do not enter initiation complex

IF3 – Keeps the 30S subunit disassociated from the 50S subunit and allows binding of mRNA


Figure 9 15 1

Figure 2-12-1

Figure 9-15-1


Figure 9 15 2

Figure 2-12-1

Figure 9-15-2


Figure 9 15 3

Figure 2-12-1

Figure 9-15-3


Chapter 9 proteins and their synthesis

Translation Initiation – Eukaryotes

  • mRNA is produced in the nucleus and transported to the cytoplasm

  • 5’ end of the mRNA is “capped” to prevent degradation

  • Eukaryotic Initiation Factors (eIF4A, eIF4B, and eIF4G) associate with the 5’ cap, the 40S subunit, and initiator tRNA

  • Complex moves 5’ to 3’ unwinding the mRNA until an initiation site (AUG) is discovered

  • Initiation factors are released and 60S subunit binds


Figure 9 16 1

Figure 2-12-1

Figure 9-16-1

  • mRNA is produced in the nucleus and transported to the cytoplasm

  • mRNA is covered with proteins and often folds on itself

  • 5’ end of the mRNA is “capped” to prevent degradation


Figure 9 16 2

Figure 2-12-1

Figure 9-16-2

4.Eukaryotic Initiation Factors (eIF4A, eIF4B, and eIF4G) associate with the 5’ cap, the 40S subunit, and initiator tRNA


Figure 9 16 3

Figure 9-16-3

5. Complex moves 5’ to 3’ unwinding the mRNA until an initiation site (AUG) is discovered


Figure 9 16 4

Figure 9-16-4

6. Initiation factors are released and 60S subunit binds


Chapter 9 proteins and their synthesis

Elongation

  • Requires two protein Elongation Factors:

    • EF-Tu and EF-G

  • Amino acids are added to the growing peptide chain at the rate of 2-15 amino acids per second


  • Chapter 9 proteins and their synthesis

    Elongation


    Chapter 9 proteins and their synthesis

    Termination

    • Release Factors – RF1, RF2 and RF3

    • RF1 recognizes UAA or UAG

    • RF2 recognizes UAA or UGA

    • RF3 assists both RF1 and RF2

    Stop codon also called a nonsense codon

    A water molecule in the peptidyltransferase center leads to the release of the peptide chain


    Chapter 9 proteins and their synthesis

    Translation differences between

    Eukaryotes and Prokaryotes

    ProkaryotesEukaryotes

    • NO nuclear membrane

      • Translation coupled to transcription

    • Ribosomes bind the Shine Dalgarno sequence

      • mRNA can contain multiple genes

    • Formylmethionine bound to initiator tRNA

    • Presence of a nuclear membrane

      • mRNA exported from nucleus

    • Ribosome binds to the 5’ cap

      • mRNA has information for only one gene

    • Methionine bound to initiator tRNA


    Chapter 9 proteins and their synthesis

    Posttranslational Folding

    Proteins must fold correctly to be functional

    Correct folding is not always energetically favorable in the cytoplasm

    Chaperones (including GroE chaperonins) bind to nascent peptides and facilitate correct folding


    Chapter 9 proteins and their synthesis

    Posttranslational modifications

    Phosphorylation

    Many proteins require some type of modification to become functional


    Chapter 9 proteins and their synthesis

    Posttranslational modifications

    Glycosylation – adding sugars

    Signaling molecules

    Cell wall proteins

    Glycoproteins


    Chapter 9 proteins and their synthesis

    Posttranslational modifications

    • Ubiquitination marks a protein for degradation

    • Short lived proteins

    • (functional in cell cycle)

    • - Damaged or mutated proteins


    Summary

    Summary

    • Translation

      • Prokaryote

      • Eukaryote

    • Post translational modifications

      • Phosphorylation

      • Glycosylation

      • Ubiquitination


  • Login