Chapter 9 proteins and their synthesis
Download
1 / 58

Chapter 9 Proteins and Their Synthesis - PowerPoint PPT Presentation


  • 58 Views
  • Uploaded on

Chapter 9 Proteins and Their Synthesis. Green Fluorescent Protein drawn in cartoon style with fluorophore highlighted as ball-and-stick; one wholly-reproduced protein, and cutaway version to show the fluorophore. Review Central Dogma. 5 ’ ATG GAC CAG TCG GTT TAA GCT 3 ’

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Chapter 9 Proteins and Their Synthesis' - newman


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Chapter 9 proteins and their synthesis
Chapter 9 Proteins and Their Synthesis

Green Fluorescent Protein drawn in cartoon style with fluorophore highlighted as ball-and-stick; one wholly-reproduced protein, and cutaway version to show the fluorophore.


Review central dogma
ReviewCentral Dogma

5’ ATG GAC CAG TCG GTT TAA GCT 3’

3’ TAC CTG GTC AGC CAA ATT CGT 5’

DNA

RNA

Protein

transcription

5’AUG GAC CAG UCG GUU UAA GCU 3’

translation

aa - aa - aa - aa - aa - aa - aa


Protein Structure

via condensation


Protein Structure

Primary Structure


Protein folding is dependent on the amino acid R groups

R

H2N C COOH

H

General Structure

There are 20 amino acids.

Their properties are determined by the R group.


There are 20 amino acids.

  • Nonpolar or hydrophobic (9)

  • Polar (hydrophillic), but uncharged (6)

  • Polar (hydrophillic), but charged (5)


Nonpolar

(Hydrophobic)

ring



Protein Structure

Primary Structure


Protein Structure

Two major types of Secondary Structure

α Helix

β Sheet



How do we get from dna to primary protein structure
How do we get from DNA to Primary protein structure ?

5’ ATG GAC CAG TCG GTT TAA GCT 3’

3’ TAC CTG GTC AGC CAA ATT CGT 5’

DNA

RNA

Protein

transcription

5’AUG GAC CAG UCG GUU UAA GCU 3’

translation

aa - aa - aa - aa - aa - aa - aa


DNA (mRNA) is read in Triplets

-Codon – Group of 3 DNA bases codes for a specific amino acid

Ex. ATG = methionine

-This means the code is degenerate – more than one codon can specify one amino acid



Key To The Genetic Code

Groups of 3 mRNA bases (codons) code for specific amino acids

5’ CCAACCGGG 3’

CCA-ACC-GGG

Pro-Thr-Gly



Proteins and Genes are Colinear

Mutations in DNA show specific corresponding changes in the protein

Genes are converted to proteins in a linear fashion


Key To The Genetic Code

CCG UGG AGA GAC UAA

Pro – Trp – Arg –Asp - Stop

CCG UCG AGA GAC UAA

Pro – Ser – Arg –Asp - Stop

CCG UGG CGA GAC UAA

Pro – Trp – Arg –Asp - Stop

CCG UGG AGA GAC UAA

Pro – Stop

CCG UGG AGA CGA CUA

Pro – Trp – Arg –Arg - Leu


The Genetic Code - Mutations

  • 4 Types of Mutations

  • Silent mutations

  • Missense mutations

  • Nonsense mutations

  • Frameshift mutations


The Genetic Code

mRNA has 3 potential “reading frames”

5’ CUUACAGUUUAUUGAUACGGAGAAGG 3’

3’ GAAUGUCAAAUAACUAUGCCUCUUCC 5’

5’CUU ACA GUU UAU UGA UAC GGA GAA GG 3’

3’GAA UGU CAA AUA ACU AUG CCU CUU CC 5’

5’ C UUA CAG UUU AUU GAU ACG GAG AAG G 3’

3’ G AAU GUC AAA UAA CUA UGC CUC UUC C 5’

5’ CU UAC AGU UUA UUG AUA CGG AGA AGG 3’

3’ GA AUG UCA AAU AAC UAU GCC UCU UCC 5’

Stop

UAA

UGA

UAG


The Genetic Code

mRNA has 3 potential reading frames

5’ CUUACAGUUUAUUGAUACGGAGAAGG 3’

3’ GAAUGUCAAAUAACUAUGCCUCUUCC 5’

5’ CUU ACA GUU UAU UGA UAC GGA GAA GG 3’

3’ GAA UGU CAA AUA ACU AUG CCU CUU CC 5’

5’ C UUA CAG UUU AUU GAU ACG GAG AAG G 3’

3’ G AAU GUC AAA UAA CUA UGC CUC UUC C 5’

5’ CU UAC AGU UUA UUG AUA CGG AGA AGG 3’

3’ GA AUG UCA AAU AAC UAU GCC UCU UCC 5’

Stop

UAA

UGA

UAG


Review - RNA

mRNA- messenger RNA

tRNA- transfer RNA

rRNA- Ribosomal RNA



tRNA-The adapter

  • -tRNA functions as the adapter between amino acids and the RNA template

  • -tRNAs are structurally similar except in two regions

    • Amino acid attachment site

    • Anticodon


tRNA-The anticodon

  • The tRNA anticodon

  • 3 base sequence

  • Complementary to the codon

  • Base pairing between the mRNA and the tRNA

  • Oriented and written in the 3’ to 5’ direction

tRNA

mRNA

3’ CUG 5’

5’ GAC 3’

Aspartic Acid


Aminoacyl-tRNA synthetase

The enzyme responsible for joining an amino acid to its corresponding tRNA

20 tRNA synthetases – 1 for each amino acid


Wobble

Allows one tRNA to recognize multiple codons

Occurs in the 3rd nucleotide of a codon


Wobble – A new set pairing of rules

I = Inosine: A rare base found in tRNA


Wobble – A new set pairing of rules

Isoaccepting tRNAs: tRNAs that accept the same amino acid but are transcribed from different genes


Wobble Problem

What anticodon would you predict for a tRNA species carrying isoleucine?


Ribosomes – General characteristics

  • Come together with tRNA and mRNA to create protein

  • Ribosome consist of one small and one large subunit

  • In prokaryotes, 30S and 50S subunits form a 70S particle

  • In Eukaryotes, 40S and 60S subunits form an 80S particle

  • Each subunit is composed of 1 to 3 types of rRNA and up to 49 proteins



Ribosomes – General characteristics

  • rRNA folds up by intramolecular base pairing



Translation

Synthesizing Protein



Translation Initiation - Prokaryotes

Translation begins at an AUG codon – Methionine

Requires a special “initiator” tRNA charged with Met – tRNAMeti

This involves the addition of a formyl group to methionine while it is attached to the initiator


Shine-Dalgarno Sequence

mRNA only associates with unbound 30S subunit


Translation Initiation – ProkaryotesInitiation Factors

3 initiation factor proteins are required for the start of translation in prokaryotes

IF1 – Binds to 30S subunit as part of the complete initiation complex. Could be involved in stability

IF2 – Binds to charged initiator tRNA and insures that other tRNAS do not enter initiation complex

IF3 – Keeps the 30S subunit disassociated from the 50S subunit and allows binding of mRNA


Figure 9 15 1

Figure 2-12-1

Figure 9-15-1


Figure 9 15 2

Figure 2-12-1

Figure 9-15-2


Figure 9 15 3

Figure 2-12-1

Figure 9-15-3


Translation Initiation – Eukaryotes

  • mRNA is produced in the nucleus and transported to the cytoplasm

  • 5’ end of the mRNA is “capped” to prevent degradation

  • Eukaryotic Initiation Factors (eIF4A, eIF4B, and eIF4G) associate with the 5’ cap, the 40S subunit, and initiator tRNA

  • Complex moves 5’ to 3’ unwinding the mRNA until an initiation site (AUG) is discovered

  • Initiation factors are released and 60S subunit binds


Figure 9 16 1

Figure 2-12-1

Figure 9-16-1

  • mRNA is produced in the nucleus and transported to the cytoplasm

  • mRNA is covered with proteins and often folds on itself

  • 5’ end of the mRNA is “capped” to prevent degradation


Figure 9 16 2

Figure 2-12-1

Figure 9-16-2

4.Eukaryotic Initiation Factors (eIF4A, eIF4B, and eIF4G) associate with the 5’ cap, the 40S subunit, and initiator tRNA


Figure 9 16 3
Figure 9-16-3

5. Complex moves 5’ to 3’ unwinding the mRNA until an initiation site (AUG) is discovered


Figure 9 16 4
Figure 9-16-4

6. Initiation factors are released and 60S subunit binds


Elongation

  • Requires two protein Elongation Factors:

    • EF-Tu and EF-G

  • Amino acids are added to the growing peptide chain at the rate of 2-15 amino acids per second



  • Termination

    • Release Factors – RF1, RF2 and RF3

    • RF1 recognizes UAA or UAG

    • RF2 recognizes UAA or UGA

    • RF3 assists both RF1 and RF2

    Stop codon also called a nonsense codon

    A water molecule in the peptidyltransferase center leads to the release of the peptide chain


    Translation differences between

    Eukaryotes and Prokaryotes

    ProkaryotesEukaryotes

    • NO nuclear membrane

      • Translation coupled to transcription

    • Ribosomes bind the Shine Dalgarno sequence

      • mRNA can contain multiple genes

    • Formylmethionine bound to initiator tRNA

    • Presence of a nuclear membrane

      • mRNA exported from nucleus

    • Ribosome binds to the 5’ cap

      • mRNA has information for only one gene

    • Methionine bound to initiator tRNA


    Posttranslational Folding

    Proteins must fold correctly to be functional

    Correct folding is not always energetically favorable in the cytoplasm

    Chaperones (including GroE chaperonins) bind to nascent peptides and facilitate correct folding


    Posttranslational modifications

    Phosphorylation

    Many proteins require some type of modification to become functional


    Posttranslational modifications

    Glycosylation – adding sugars

    Signaling molecules

    Cell wall proteins

    Glycoproteins


    Posttranslational modifications

    • Ubiquitination marks a protein for degradation

    • Short lived proteins

    • (functional in cell cycle)

    • - Damaged or mutated proteins


    Summary
    Summary

    • Translation

      • Prokaryote

      • Eukaryote

    • Post translational modifications

      • Phosphorylation

      • Glycosylation

      • Ubiquitination


    ad