DNA

1. DNA

2. DNA • must carry information • must be replicatable (inheritance) • must be changeable (mutation)

3. DNA

4. DNA structure deoxyribonucleic acid - two directional polynucleotide strands in a double helix

5. A brief digression for terminology: 5 Carbon molecules in rings are numbered…. C O C C 1 4 C C 3 2

6. two directional polynucleotide strands in double helix start with a ribose sugar…

7. two directional polynucleotide strands in double helix start with a ribose sugar… remove an oxygen at carbon 2’….

8. two directional polynucleotide strands in double helix start with a ribose sugar… remove an oxygen at carbon 2’…. add a phosphate group at 5’ side add a nitrogenous base at 1’ side = a nucleotide

9. two directional polynucleotide strands in double helix A nucleotide, or base

10. Bases = purines (adenine, guanine) and pyrimidines (cytosine, thymine)

11. two directional polynucleotide strands in double helix nucleotides are linked in chains with a phosphodiester bond free ends of chain will have 5’ phosphate at one end, 3’ hydroxyl at the other end 5’ end phosphodiester bond 3’ end

12. two directional polynucleotide strands in double helix nucleotides are linked in chains with a phosphodiester bond free ends of chain will have 5’ phosphate at one end, 3’ hydroxyl at the other end 5’ end 3’ end

13. two directional polynucleotide strandsin double helix Hydrogen bonds

14. two directional polynucleotide strands in double helix Two strands pair up, nucleotides linked with hydrogen bonds adenosine pairs with thymine cytosine pairs with guanine

15. two directional polynucleotide strands in double helix Two strands pair up, nucleotides linked with hydrogen bonds adenosine pairs with thymine cytosine pairs with guanine - abbreviated as “base pairs”

16. twodirectionalpolynucleotide strandsin double helix Strands have polarity - 5'-hydroxyl group of first nucleotide at one end, 3'-hydroxyl group at other end (5’ to 3’ strand) Strands run antiparallel: (5' -> 3') ATGGAATTCTCGCTC (3' <- 5') TACCTTAAGAGCGAG

17. DNA replication: two strands are both available as templates for new strand result is doubling (2 complete new double helices)

18. DNA replication: is semiconservative always occurs in5’ to 3’ direction

19. DNA replication: occurs at multiple replication forks (bubbles) along the DNA strand

20. Important: there are several DNA polymerases involved in replication DNA polymerases have a proof-reading and editing function (exonuclease activity)

21. TRANSCRIPTION

22. Consider: if all DNA was actively used: - most mutations would be lethal - there would be no ‘raw material’ for evolutionary change - what would happen to genes de-activated by mutation? In fact, many errors and duplications leave ‘extra’ DNA

23. Consider: If there is excess DNA, it may be - only between genes - also interspersed within genes

24. Consider: If there is excess DNA, it may be - only between genes - also interspersed within genes

25. Consider: Not all gene products are required simultaneously; needs for proteins change or differ - during development (e.g., milk digesting enzymes) - over time (e.g., digestive enzymes) - among organs (e.g., liver enzymes not used in muscle) - in response to stimuli (e.g., melanin, adrenalin) therefore regulation of gene activity is needed

26. Transcription: Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed (regulation)

27. Transcription: Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed (regulation) RNA is ribonucleic acid - has uracil instead of thymine - sugar is ribose instead of deoxyribose

28. There are three types of RNA: mRNA: messenger RNA – carries the code for a gene rRNA: ribosomal RNA – used to construct ribosomes tRNA: transfer RNA – short adapters to carry amino acid and its anti-codon

29. DNA strand (double, helical) - permanent (5' -> 3') ATGGAATTCTCGCTC   (coding, sense strand) (3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand)

30. DNA strand (double, helical) - permanent (5' -> 3') ATGGAATTCTCGCTC   (coding, sense strand) (3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand) mRNA strand (single, linear) – temporary, as needed (5' -> 3') AUGGAAUUCUCGCUC  (from template strand)

31. DNA strand (double, helical) - permanent (5' -> 3') ATGGAATTCTCGCTC   (coding, sense strand) (3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand) mRNA strand (single, linear) – temporary, as needed (5' -> 3') AUGGAAUUCUCGCUC  (from template strand) note: by taking information from the template (antisense) strand of DNA, mRNA becomes the coding sequence

32. DNA strand (double, helical) - permanent (5' -> 3') ATGGAATTCTCGCTC   (coding, sense strand) (3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand) mRNA strand (single, linear) – temporary, as needed (5' -> 3') AUGGAAUUCUCGCUC  (from template strand) protein sequence (single, with 1, 2, 3, 4 structure) Met-Glu-Phe-Ser-Leu...

33. Gene structure promoter region: immediately upstream (5’ end) of its gene

34. Steps in transcription: 1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes

35. Steps in transcription: 1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes 2. elongation - similar to DNA replication - only one strand (template) is used

36. Steps in transcription: 1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes 2. elongation - similar to DNA replication - only one strand (template) is used 3. termination - transcription keeps going for 1000-2000 bases beyond end of ‘gene’

37. After transcription: RNA processing capping polyadenylation intron removal UTR= untranslated region promoter elements

38. TRANSLATION: The Genetic Code

39. The genetic code DNA and RNA have 4 types of bases proteins are composed of amino acids, of which there are 20 - so how do 4 bases encode 20 amino acids?

40. The genetic code “words” with a single base allow no combinations (4 words) “words” with two bases allow 16 combinations (42) “words” with three bases allow 64 combinations (43) = more than enough combinations for 20 amino acids

41. The genetic code • composed of nucleotide triplets (codons) mRNA AUGGAAUUCUCGCUC protein sequence Met Glu Phe Ser Leu

42. The genetic code • composed of nucleotide triplets (codons) • non-overlapping mRNA AUGGAAUUCUCGCUC protein sequence Met Glu Phe Ser Leu NOT AUGGAAUUCUCGCUC

43. The genetic code • composed of nucleotide triplets (codons) • non-overlapping • unambiguous – each codon only specifies one amino acid • degenerate – most amino acids specified by several codons

44. second position third position first position

45. Reading frame must be uniquely specified: theredfoxatethehotdog t her edf oxa tet heh otd og th ere dfo xat eth eho tdo g the red fox ate the hot dog

46. start codon

47. Reading frame must be uniquely specified: mRNA code begins with start codon (AUG) protein is constructed along open reading frame translation stops at stop codon (UAA, UAG, or UGA) (only in frame: sequence out of frame does not work)

48. 5’ 3’ GUCCCGUGAUGCCGAGUUGGAGUAAGUAACCU met pro ser trp ser lys stop Reading frame must be uniquely specified: mRNA code begins with start codon (AUG) protein is constructed along open reading frame translation stops at stop codon (UAA, UAG, or UGA) (only in frame: sequence out of frame does not work)

49. The genetic code • composed of nucleotide triplets (codons) • non-overlapping • unambiguous • degenerate • nearly universal – except for portions of mitochondrial DNA and a few procaryotes

50. TRANSLATION: assembling proteins