1 / 7

Strategy of Redesign for CTLMA2 Target Site

Strategy of Redesign for CTLMA2 Target Site. AniI WT: T GA G G AG GTT TC TCTGT A AA || | ||| ||||| || CTLMA2 : A GA A G CC GTT CA TCTGT C AA. Saturation mutagenesis / Random mutagenesis. Mutagenesis based on Rosseta design.

mira-burke
Download Presentation

Strategy of Redesign for CTLMA2 Target Site

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Strategy of Redesign for CTLMA2 Target Site AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA Saturation mutagenesis / Random mutagenesis Mutagenesis based on Rosseta design Semi-saturation mutagenesis based on the X-tal structure +1C/+2A/+8C -5C/-4C -7A Semi-saturation mutagenesis to promote the catalysis Semi-saturation mutagenesis based on the X-tal structure Random mutagenesis -10A/-7A -5C/-4C Semi-saturation mutagenesis to optimize the catalysis CTLMA2 site -10A/-7A/-5C/-4C

  2. AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA G : C A : T Redesign for -7A T29 T22 R72 K23 -7G >-7A -7C >-7T (Gray, WT target; magenta, CTLMA2 target) Introduced mutations at T22, K23 and T29, in order to alter the contact with the bottom strand base at the position -7.

  3. pEndo HE Selection for -7A Transformation Amino-acid substitutions F, L, I, V, Y, H, N, D, C, R, S, and G at T22 and T29 M, P, T, A, Q, K, E, W, F, L, I, V, Y, H, N, D, C, R, S, and G at K23 pCcdB Target + Arabinose Induction of HE gene 15 h Induction of both HE and CcdB genes + Arabinose + IPTG Data from 2 independent experiments T22Y/K23G/T29S was chosen for the next selection (-10A/-7A).

  4. Redesign for -10A/-7A AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA K26 Y27 G25 K24 -10T >-10A T29 > S29 T22 >Y22 K23 >G23 -10T >-10A -10A >-10T -7A -7T -10A >-10T (Gray, WT target; magenta, CTLMA2 target) Introduced mutations at K24, G25, K26, and Y27 in Y2 + T22Y/K23G/T29S background.

  5. Redesign for -5C/-4C AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA A68 G33 Y18 E31 R59 S20 -5G > -5C -5G >-5C -4G > -4C -4G >-4C (Gray, WT target; magenta, CTLMA2 target) Introduced mutations at Y18, S20, E31, G33, R59 and A68, based on Rossetta design.

  6. pEndo HE Selection for -5C/-4C Amino-acid substitutions S and Y at Y18; Q, K and S at S20; R, S, Q, A and E at E31; S, R and G at G33;F, L, I, V, H, N, D, C, R, S, G, and Y at R59; T, R, I, and S at A68 Transformation pCcdB Target + Arabinose Induction of HE gene 24 h Induction of both HE and CcdB genes + Arabinose + IPTG * Mutation induced through PCR amplification Data from 2 independent experiments G33R/V56I/R59S/A68R was subjected to the next selection to promote the cleavage activity.

  7. Redesign for -5C/-4C (2nd round) V56 > I56 I55 A68 >R68 S57 G33 > R33 E35 R59 >S59 -5G > -5C -4G > -4C (Gray, WT target; magenta, CTLMA2 target) Introduced hydrophilic residues at E35, I55, S57 and S59.

More Related