videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm - PowerPoint PPT Presentation

1 / 21

  • Uploaded on
  • Presentation posted in: General Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Videos howstuffworks hsw 24990 genetics understanding dna video htm

Understanding DNA: How Stuff Works

Videos howstuffworks hsw 24990 genetics understanding dna video htm


Videos howstuffworks hsw 24990 genetics understanding dna video htm

GeneticVariation:A Key to Survival

Videos howstuffworks hsw 24990 genetics understanding dna video htm


leads to


Videos howstuffworks hsw 24990 genetics understanding dna video htm


How do malaria parasites survive anti-malaria medications?

Videos howstuffworks hsw 24990 genetics understanding dna video htm

How Do CellsReproduce?

Different copy

Identical copy

Videos howstuffworks hsw 24990 genetics understanding dna video htm

Mixing of Genes


Mini lab observing cell reproduction

MINI-LAB: Observing cell reproduction

  • Mount a prepared slide of a cell undergoing cell division.

    2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes

    3. Describe what you see.

  • Note: Follow guidelines on

  • Making Diagrams

  • Accurate representation

  • 2-D diagram

  • Proper labels

  • Neatly presented

Videos howstuffworks hsw 24990 genetics understanding dna video htm

Crossing over: Why we are different from our parents

VC; Where do genes come from

Videos howstuffworks hsw 24990 genetics understanding dna video htm

From Geneto Protein: An exercise in breaking the code

Dna copies itself base pairings a t c g dna molecule unzips breaking the base pairs forming 2 sides

DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides

VC: DNA Replication

A taccggatgccagatcaaatc what is the other side

A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________

Given the code of a DNA molecule, what would be the code of the new DNA strand?

B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________

Videos howstuffworks hsw 24990 genetics understanding dna video htm

VC: How DNA copies itself

From DNA to protein

Videos howstuffworks hsw 24990 genetics understanding dna video htm

2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U.

A: ____________________________________

B: ____________________________________

Videos howstuffworks hsw 24990 genetics understanding dna video htm

3. CODE IS TRANSLATED. The code is read in groups of 3 called codons).

A: ____________________________________

B: ____________________________________

Videos howstuffworks hsw 24990 genetics understanding dna video htm

Find the Amino Acid sequence that is coded:

Use the following guide.

A: ____________________________________

B: ____________________________________

Videos howstuffworks hsw 24990 genetics understanding dna video htm

New copy (RNA) is read and translated


Make copies of itself

Crossover (mixing of code)

Amino acids (protein) are formed

A trait is expressed

VC: What is phenotype

Videos howstuffworks hsw 24990 genetics understanding dna video htm

Cracking the Code


VC: Cracking the code

copied and read




Videos howstuffworks hsw 24990 genetics understanding dna video htm

While the copying of DNA is a very accurate process, what happens when a letter is altered?

VC: DNA Mutation

A taccggatgccagatcaaatc what is the other side1

A: TACCGGATGCCAGATCAAATCWhat is the other side?

Given the code of a DNA molecule, what would be the code of the new DNA strand?



  • Login