Http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm
Download
1 / 21

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm - PowerPoint PPT Presentation


  • 129 Views
  • Uploaded on

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm' - masao


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

Understanding DNA: How Stuff Works


DNAhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm BASE PAIRS


Genetichttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmVariation:A Key to Survival


GENETIC VARIATIONhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

leads to

Adaptation


RESISTANT STRAINhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

How do malaria parasites survive anti-malaria medications?


How Do http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmCellsReproduce?

http://luigigalvani5.blogspot.com/2008/...ary.html

http://waynesword.palomar.edu/lmexer2a.htm

Different copy

Identical copy


Mixhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htming of Genes

CROSSING OVER


Mini lab observing cell reproduction
MINI-LAB: Observing cell reproductionhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

  • Mount a prepared slide of a cell undergoing cell division.

    2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes

    3. Describe what you see.

  • Note: Follow guidelines on

  • Making Diagrams

  • Accurate representation

  • 2-D diagram

  • Proper labels

  • Neatly presented


Crossinghttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm over: Why we are different from our parents

VC; Where do genes come from


From http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmGeneto Protein: An exercise in breaking the code


Dna copies itself base pairings a t c g dna molecule unzips breaking the base pairs forming 2 sides
DNA COPIES ITSELFhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides

VC: DNA Replication


A taccggatgccagatcaaatc what is the other side
A: http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmTACCGGATGCCAGATCAAATCWhat is the other side?__________________________

Given the code of a DNA molecule, what would be the code of the new DNA strand?

B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________


VC: http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmHow DNA copies itself

From DNA to protein


2.http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmCODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U.

A: ____________________________________

B: ____________________________________


3. http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmCODE IS TRANSLATED. The code is read in groups of 3 called codons).

A: ____________________________________

B: ____________________________________


Find the http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmAmino Acid sequence that is coded:

Use the following guide.

A: ____________________________________

B: ____________________________________


New copy (RNA) is read and translatedhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

Genes(DNA)

Make copies of itself

Crossover (mixing of code)

www.squidoo.com/geneticsresearch

Amino acids (protein) are formed

A trait is expressed

VC: What is phenotype


Crackinghttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm the Code

DNA

VC: Cracking the code

copied and read

RNA

translated

http://entomology.wisc.edu/~goodman/wgr...rch.html

PROTEIN


While the copying of http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmDNA is a very accurate process, what happens when a letter is altered?

VC: DNA Mutation


A taccggatgccagatcaaatc what is the other side1
A: http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmTACCGGATGCCAGATCAAATCWhat is the other side?

Given the code of a DNA molecule, what would be the code of the new DNA strand?

AT_GCCTACGGTCTAGTTTAG

B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCGCCCGCATTGGTGTTGA


ad