slide1
Download
Skip this Video
Download Presentation
videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm

Loading in 2 Seconds...

play fullscreen
1 / 21

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm - PowerPoint PPT Presentation


  • 130 Views
  • Uploaded on

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm' - masao


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

Understanding DNA: How Stuff Works

slide4

GENETIC VARIATION

leads to

Adaptation

slide5

RESISTANT STRAIN

How do malaria parasites survive anti-malaria medications?

slide6

How Do CellsReproduce?

http://luigigalvani5.blogspot.com/2008/...ary.html

http://waynesword.palomar.edu/lmexer2a.htm

Different copy

Identical copy

slide7

Mixing of Genes

CROSSING OVER

mini lab observing cell reproduction
MINI-LAB: Observing cell reproduction
  • Mount a prepared slide of a cell undergoing cell division.

2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes

3. Describe what you see.

  • Note: Follow guidelines on
  • Making Diagrams
  • Accurate representation
  • 2-D diagram
  • Proper labels
  • Neatly presented
dna copies itself base pairings a t c g dna molecule unzips breaking the base pairs forming 2 sides
DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides

VC: DNA Replication

a taccggatgccagatcaaatc what is the other side
A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________

Given the code of a DNA molecule, what would be the code of the new DNA strand?

B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________

slide13

VC: How DNA copies itself

From DNA to protein

slide14

2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U.

A: ____________________________________

B: ____________________________________

slide15

3. CODE IS TRANSLATED. The code is read in groups of 3 called codons).

A: ____________________________________

B: ____________________________________

slide16

Find the Amino Acid sequence that is coded:

Use the following guide.

A: ____________________________________

B: ____________________________________

slide18

New copy (RNA) is read and translated

Genes(DNA)

Make copies of itself

Crossover (mixing of code)

www.squidoo.com/geneticsresearch

Amino acids (protein) are formed

A trait is expressed

VC: What is phenotype

slide19

Cracking the Code

DNA

VC: Cracking the code

copied and read

RNA

translated

http://entomology.wisc.edu/~goodman/wgr...rch.html

PROTEIN

slide20

While the copying of DNA is a very accurate process, what happens when a letter is altered?

VC: DNA Mutation

a taccggatgccagatcaaatc what is the other side1
A: TACCGGATGCCAGATCAAATCWhat is the other side?

Given the code of a DNA molecule, what would be the code of the new DNA strand?

AT_GCCTACGGTCTAGTTTAG

B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCGCCCGCATTGGTGTTGA

ad