Http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm
This presentation is the property of its rightful owner.
Sponsored Links
1 / 21

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on
  • Presentation posted in: General

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.

Download Presentation

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Videos howstuffworks hsw 24990 genetics understanding dna video htm

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm

Understanding DNA: How Stuff Works


Videos howstuffworks hsw 24990 genetics understanding dna video htm

DNA BASE PAIRS


Videos howstuffworks hsw 24990 genetics understanding dna video htm

GeneticVariation:A Key to Survival


Videos howstuffworks hsw 24990 genetics understanding dna video htm

GENETIC VARIATION

leads to

Adaptation


Videos howstuffworks hsw 24990 genetics understanding dna video htm

RESISTANT STRAIN

How do malaria parasites survive anti-malaria medications?


Videos howstuffworks hsw 24990 genetics understanding dna video htm

How Do CellsReproduce?

http://luigigalvani5.blogspot.com/2008/...ary.html

http://waynesword.palomar.edu/lmexer2a.htm

Different copy

Identical copy


Videos howstuffworks hsw 24990 genetics understanding dna video htm

Mixing of Genes

CROSSING OVER


Mini lab observing cell reproduction

MINI-LAB: Observing cell reproduction

  • Mount a prepared slide of a cell undergoing cell division.

    2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes

    3. Describe what you see.

  • Note: Follow guidelines on

  • Making Diagrams

  • Accurate representation

  • 2-D diagram

  • Proper labels

  • Neatly presented


Videos howstuffworks hsw 24990 genetics understanding dna video htm

Crossing over: Why we are different from our parents

VC; Where do genes come from


Videos howstuffworks hsw 24990 genetics understanding dna video htm

From Geneto Protein: An exercise in breaking the code


Dna copies itself base pairings a t c g dna molecule unzips breaking the base pairs forming 2 sides

DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides

VC: DNA Replication


A taccggatgccagatcaaatc what is the other side

A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________

Given the code of a DNA molecule, what would be the code of the new DNA strand?

B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________


Videos howstuffworks hsw 24990 genetics understanding dna video htm

VC: How DNA copies itself

From DNA to protein


Videos howstuffworks hsw 24990 genetics understanding dna video htm

2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U.

A: ____________________________________

B: ____________________________________


Videos howstuffworks hsw 24990 genetics understanding dna video htm

3. CODE IS TRANSLATED. The code is read in groups of 3 called codons).

A: ____________________________________

B: ____________________________________


Videos howstuffworks hsw 24990 genetics understanding dna video htm

Find the Amino Acid sequence that is coded:

Use the following guide.

A: ____________________________________

B: ____________________________________


Videos howstuffworks hsw 24990 genetics understanding dna video htm

New copy (RNA) is read and translated

Genes(DNA)

Make copies of itself

Crossover (mixing of code)

www.squidoo.com/geneticsresearch

Amino acids (protein) are formed

A trait is expressed

VC: What is phenotype


Videos howstuffworks hsw 24990 genetics understanding dna video htm

Cracking the Code

DNA

VC: Cracking the code

copied and read

RNA

translated

http://entomology.wisc.edu/~goodman/wgr...rch.html

PROTEIN


Videos howstuffworks hsw 24990 genetics understanding dna video htm

While the copying of DNA is a very accurate process, what happens when a letter is altered?

VC: DNA Mutation


A taccggatgccagatcaaatc what is the other side1

A: TACCGGATGCCAGATCAAATCWhat is the other side?

Given the code of a DNA molecule, what would be the code of the new DNA strand?

AT_GCCTACGGTCTAGTTTAG

B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCGCCCGCATTGGTGTTGA


  • Login