Genetic transformation and protein synthesis
This presentation is the property of its rightful owner.
Sponsored Links
1 / 42

Genetic Transformation and Protein Synthesis PowerPoint PPT Presentation


  • 50 Views
  • Uploaded on
  • Presentation posted in: General

Genetic Transformation and Protein Synthesis. Basic Unit of Life. Cells Made of outside (cell membrane) Inside (cytoplasm and organelles) Governed by genetic material (DNA) DNA wrapped in a membrane = nucleus Characteristic of EUKARYOTIC cells (plants, animals, fungi, protists , etc)

Download Presentation

Genetic Transformation and Protein Synthesis

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Genetic transformation and protein synthesis

Genetic Transformationand Protein Synthesis


Basic unit of life

Basic Unit of Life

  • Cells

  • Made of

    • outside (cell membrane)

    • Inside (cytoplasm and organelles)

  • Governed by genetic material (DNA)

    • DNA wrapped in a membrane = nucleus

      • Characteristic of EUKARYOTIC cells (plants, animals, fungi, protists, etc)

    • DNA loose in cytoplasm = nucleoid region

      • Characteristic of PROKARYOTIC CELLS (Bacteria)


Dna extraction

DNA Extraction

  • Virtual lab

  • http://learn.genetics.utah.edu/content/labs/extraction/


Are their cells different sizes

Are their cells different sizes?


Cell size

Cell Size

  • Cells cannot grow to unlimited size

  • Nucleus cannot control movement into and out of cell membrane

  • Not enough of assorted organelles to get necessary work done (proteins made, waste removed, etc.)

  • Key is surface area to volume ratio

    • A cell must have enough membrane on the outside (ie, surface area) to control what enters and leaves the cell.


Fill in the data chart

Fill in the data chart


Cells divide so they can maintain homeostasis

Cells divide so they can maintain homeostasis.

  • Requires copies of all cell contents including DNA

  • DNA copies by semi-conservative replication.

    • Each strand is half old and half new.

  • MITOSIS: Basic cell division for growth and repair.

    • Interphase(G1, S and G2)

    • M phase:

      Prophase, Metaphase, Anaphase,

      and Telophase …

    • followed by Cytokinesis

    • Results in two “daughter” cells


Genetic transformation and protein synthesis

Phases of the cell cycle:


Dna structure the double helix

DNA Structure: The Double Helix

  • Basic unit is a nucleotide made of:

  • Sugar (deoxyribose)

  • Phosphate

  • Nitrogenous base

    • purines (double ring)

    • pyrimidines (single ring)


Photo 51

Photo 51


Dna replication occurs in s portion of interphase

DNA Replication occurs in “S” portion of Interphase.

  • DNA must be copied so every new cell has the same number and same kind of chromosomes as every other cell.

  • Process is

    semi-conservative


Replication vocabulary

Replication Vocabulary

  • Replication fork = point were strands separate

  • Helicase = enzyme that separates strands

  • DNA polymerase = enzyme that keeps strands separated as nucleotides are added one at a time to complement the exposed strands

  • Repair enzymes = proofread and fix errors


Deoxyribose a 5 carbon pentose sugar

Deoxyribose : a 5-carbon (pentose) sugar

Phosphate joins at 5’ and 3’ carbons.

Bases join at the 1’ carbon.


Replication bubble

Replication Bubble

DNA strands are copied in both directions from the replication fork. As the strands enlarge and fuse, they begin to resemble a bubble.


Nucleotides can be added only in 5 to 3 direction

Nucleotides can be added ONLY in 5’ to 3’ direction


Synthesis of the complementary daughter dna strands

Synthesis of the complementary daughter DNA strands

Leading strand

Direction of fork

Okazaki fragments connected by DNA ligase

DNA polymerases carry out DNA synthesis on a DNA template, exclusively in 5’ to 3’ direction.

3’

5’

5’

3’

3’

5’

3’

Lagging strand

5’


Genetic transformation and protein synthesis

Lagging strand: DNA synthesis is discontinuous

replication fork

New RNA primer

5’

3’

3’

New Okazaki fragment building up

5’

3’

3’

New Okazaki fragment finished

5’

3’

3’

Old primer erased and replaced by DNA

5’

3’

3’

Nick sealing by DNA ligase joins new Okazaki fragment to the growing strand

Lagging strand template

5’

3’

3’

5’

Okazaki fragment (~200 nucleotides)


How is rna different from dna

How is RNA different from DNA?


Types of rna

Types of RNA

  • Messenger RNA (mRNA) – consists of RNA nucleotides in the form of a single uncoiled chain.

    • mRNA carries genetic information from the nucleus to the cytosol.

  • Transfer RNA (tRNA) - consists of a single chain of about

    80 RNA nucleotides folded into a hairpin shape that binds to specific amino acids.

    • tRNA carries amino acids from the cytoplasm to the ribosomes.

    • About 45 varieties of tRNA.

  • Ribosomal RNA (rRNA) - most abundant form of RNA.

    • rRNA consists of RNA nucleotides in a globular cluster.

    • Joined by proteins, rRNA makes up the ribosomes where proteins are made.


How do we know that dna is the genetic material of inheritance

How do we know that DNA is the genetic material of inheritance?


Frederick griffith transformation

Frederick Griffith: transformation

  • Worked with bacteria:

  • Virulent strain killed mice

  • Nonvirulent strain did not kill mice.

  • Heat killed virulent bacteria and mice lived.

  • Mixture of non-virulent and heat-killed virulent killed mice.

A

B

C

D


Oswald avery what is the agent of transformation

Oswald Avery: What is the agent of transformation?

  • Transformation

    – The transfer of genetic material from one organism to another

    • ex: Bacteria taking up foreign DNA

    • Using an enzyme to destroy DNA, Avery showed that transformation stopped.

    • Proved that DNA was the molecule involved in genetic heredity and transformation.


Hershey chase

Hershey & Chase

  • Used radioactive isotopes to label parts of a virus

    • Sulfur = protein marker

    • Phosphorous = DNA marker

After infection of bacteria by the labeled virus, the scientists found radio-phosphorous inside infected bacteria. So they knew it was the DNA and not the protein coat that was injected by the virus.


Genetic transformation and protein synthesis

Deoxyribose sugars are bonded to phosphate groups by phosphodiesterbonds.

The phosphates on either side of the sugar are bonded to different carbons.


Complementary base pairing

Complementary Base Pairing

Adenine-Thymine

Held together by two hydrogen bonds

Cytosine-Guanine

Held together by three hydrogen bonds.


Genetic transformation and protein synthesis

THE STRUCTURE OF DUPLICATED CHROMOSOMES

AS SEEN IN METAPHASE

Shorter

arm

Longer

arm

Sister chromatids


Genetic transformation and protein synthesis

Human karyotype: n=23, 2n=46


Genetic transformation and protein synthesis

A chromosome consisting two identical sister chromatids

Attachment site:

kinetochor at the centromer


Genetic transformation and protein synthesis

Protein Synthesis


Genetic transformation and protein synthesis

  • TRANSCRIPTION

  • Occurs in the nucleus

  • DNA template opens

  • Pre mRNA is built

  • Introns with unnecessary info are deleted

  • Remaining exons are joined by enzymes to form mRNA.

  • DNAmRNA

  • TRANSLATION

  • Occurs at the ribosome

  • tRNA delivers amino acids which are joined by peptide bonds to form a protein

  • tRNA is reloaded with an amino acid by enzymes in the cytoplasm


Pre mrna

pre-mRNA

  • Both introns and exons are translated from the DNA template.

  • Enzymes cut out introns and join exons to form mRNA.

  • Exon: Section of a gene translated into a protein.

  • Intron: Section of a gene NOT translated.


Genetic transformation and protein synthesis

  • Promoter - a nucleotide sequence on a DNA molecule that, when attached to an RNA polymerase molecule, will initiate transcription of a specific structural gene.

  • Repressor Protein – a protein that inhibits a specific gene from being expressed.

  • Termination Signal - a specific sequence of nucleotides that marks the end of a gene sequence be copied.


Enhancer genes

Enhancer Genes

  • An area of nucleotides that must first be translated in order for adjoining gene to be translated.


Translation

Translation

  • tRNA molecules bring amino acids from various locations in the cytoplasm to the ribosome

  • Note that tRNA is made of nucleotides

  • Amino acids attach at the top, while anticodon is at opposite end


Aug ucu gcc aaa cag ucu gua caa ggu uaa

AUGUCUGCCAAACAGUCUGUACAAGGUUAA


Aug ucu gcc aaa cag ucu gua caa ggu uaa1

AUGUCUGCCAAACAGUCUGUACAAGGUUAA


Mutations

Mutations

  • Changes in nucleotide sequence

  • Are usually fatal to the cell, but vital for increasing genetic variety

  • Types:


Translocation

Translocation


Prokaryotic gene regulation

Prokaryotic Gene Regulation

  • Not all genes are expressed as proteins

  • Promoters = bonding sites for RNA polymerase

  • Other sequences mean start or stop

  • Operon = group of genes that work together

    • Example: Lac operon system in E. coli

    • Repressors turn off lac genes; presence of lactose turns on lac genes


Eukaryotic gene regulation

Eukaryotic Gene Regulation

  • More complex than bacteria

  • Repeating thymine and adenine sequences called “TATA box” is followed by start nucleotide sequence

  • RNA polymerase locates TATA box and begins transcription immediately after it

  • Enhancer genes – located before start sequence of nucleotides; site of protein binding to facilitate transcription

  • Hox genes – control master body plan


  • Login