Rna secondary structure
1 / 44

RNA Secondary Structure - PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Decoding: the CYK algorithm. Given x = x 1 ....x N , and a SCFG G, Find the most likely parse of x

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

RNA Secondary Structure

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Rna secondary structure

RNA Secondary Structure






Decoding the cyk algorithm

Decoding: the CYK algorithm

Given x = x1....xN, and a SCFG G,

Find the most likely parse of x

(the most likely alignment of G to x)

Dynamic programming variable:

(i, j, V):likelihood of the most likely parse of xi…xj,

rooted at nonterminal V


(1, N, S): likelihood of the most likely parse of x by the grammar

The cyk algorithm cocke younger kasami






The CYK algorithm (Cocke-Younger-Kasami)


For i = 1 to N, any nonterminal V,

(i, i, V) = log P(V  xi)


For i = 1 to N – 1

For j = i+1 to N

For any nonterminal V,

(i, j, V) = maxXmaxYmaxik<j (i,k,X) + (k+1,j,Y) + log P(VXY)


log P(x | , *) = (1, N, S)

Where * is the optimal parse tree (if traced back appropriately from above)

A scfg for predicting rna structure

A SCFG for predicting RNA structure

S  a S | c S | g S | u S | 

 S a | S c | S g | S u

 a S u | c S g | g S u | u S g | g S c | u S a

 SS

  • Adjust the probability parameters to reflect bond strength etc

  • No distinction between non-paired bases, bulges, loops

  • Can modify to model these events

    • L: loop nonterminal

    • H: hairpin nonterminal

    • B: bulge nonterminal

    • etc

Cyk for rna folding

CYK for RNA folding


(i, i-1) = log P()


For i = 1 to N

For j = i to N

(i+1, j–1) + log P(xi S xj)

(i, j–1) + log P(S xi)

(i, j) = max

(i+1, j) + log P(xi S)

maxi < k < j (i, k) + (k+1, j) + log P(S S)



Recall HMMs:

Forward:fl(i) = P(x1…xi, i = l)

Backward:bk(i) = P(xi+1…xN | i = k)


P(x) = k fk(N) ak0 = l a0l el(x1) bl(1)

Analogue in SCFGs:

Inside:a(i, j, V) = P(xi…xj is generated by nonterminal V)

Outside: b(i, j, V) = P(x, excluding xi…xj is generated by S and the excluded part is rooted at V)

The inside algorithm

The Inside Algorithm

To compute

a(i, j, V) = P(xi…xj, produced by V)

a(i, j, v) = X Y k a(i, k, X) a(k+1, j, Y) P(V  XY)








Algorithm inside

Algorithm: Inside


For i = 1 to N, V a nonterminal,

a(i, i, V) = P(V  xi)


For i = 1 to N-1

For j = i+1 to N

For V a nonterminal

a(i, j, V) = X Y k a(i, k, X) a(k+1, j, X) P(V  XY)


P(x | ) = a(1, N, S)

The outside algorithm

The Outside Algorithm

b(i, j, V) = Prob(x1…xi-1, xj+1…xN, where the “gap” is rooted at V)

Given that V is the right-hand-side nonterminal of a production,

b(i, j, V) = X Y k<i a(k, i – 1, X) b(k, j, Y) P(Y  XV)







Algorithm outside

Algorithm: Outside


b(1, N, S) = 1

For any other V, b(1, N, V) = 0


For i = 1 to N-1

For j = N down to i

For V a nonterminal

b(i, j, V) = X Y k<i a(k, i – 1, X) b(k, j, Y) P(Y  XV) +

X Y k<i a(j+1, k, X) b(i, k, Y) P(Y  VX)


It is true for any i, that:

P(x | ) = X b(i, i, X) P(X  xi)

Learning for scfgs

Learning for SCFGs

We can now estimate

c(V) = expected number of times V is used in the parse of x1….xN


c(V) = –––––––– 1iNijN a(i, j, V) b(i, j, v)

P(x | )


c(VXY) = –––––––– 1iNi<jN ik<j b(i,j,V) a(i,k,X) a(k+1,j,Y) P(VXY)

P(x | )

Learning for scfgs1

Learning for SCFGs

Then, we can re-estimate the parameters with EM, by:


Pnew(VXY) = ––––––––––––


c(V  a) i: xi = a b(i, i, V) P(V  a)

Pnew(V  a) = –––––––––– = ––––––––––––––––––––––––––––––––

c(V) 1iNi<jN a(i, j, V) b(i, j, V)

Summary scfg and hmm algorithms

Summary: SCFG and HMM algorithms

GOALHMM algorithmSCFG algorithm

Optimal parseViterbiCYK



LearningEM: Fw/BckEM: Ins/Outs

Memory ComplexityO(N K)O(N2 K)

Time ComplexityO(N K2)O(N3 K3)

Where K: # of states in the HMM

# of nonterminals in the SCFG

The zuker algorithm main ideas

position i

length l



position i



position j

position j

The Zuker algorithm – main ideas

Models energy of a fold in terms of specific features:

  • Pairs of base pairs (stacked pairs)

  • Bulges

  • Loops (size, composition)

  • Interactions between stem and loop

position j’

positions i


position j


Phylogeny tree reconstruction











Phylogeny Tree Reconstruction

Inferring phylogenies

Inferring Phylogenies

Trees can be inferred by several criteria:

  • Morphology of the organisms

    • Can lead to mistakes!

  • Sequence comparison







Modeling evolution

Modeling Evolution

During infinitesimal time t, there is not enough time for two substitutions to happen on the same nucleotide

So we can estimate P(x | y, t), for x, y  {A, C, G, T}

Then let

P(A|A, t) …… P(A|T, t)

S(t) = ……


P(T|A, t) ……P(T|T, t)





Modeling evolution1

Modeling Evolution



Reasonable assumption: multiplicative

(implying a stationary Markov process)

S(t+t’) = S(t)S(t’)

That is, P(x | y, t+t’) = z P(x | z, t) P(z | y, t’)

Jukes-Cantor: constant rate of evolution

1 - 3   

For short time , S() = I+R =  1 - 3  

  1 - 3 

   1 - 3



Modeling evolution2

Modeling Evolution


For longer times,

r(t)s(t) s(t) s(t)

S(t) = s(t)r(t) s(t) s(t)

s(t)s(t) r(t) s(t)

s(t)s(t) s(t) r(t)

Where we can derive:

r(t) = ¼ (1 + 3 e-4t)

s(t) = ¼ (1 – e-4t)

S(t+) = S(t)S() = S(t)(I + R)


(S(t+) – S(t))/ = S(t) R

At the limit of   0,

S’(t) = S(t) R


r’ = -3r + 3s

s’ = -s + r

Those diff. equations lead to:

r(t) = ¼ (1 + 3 e-4t)

s(t) = ¼ (1 – e-4t)

Modeling evolution3

Modeling Evolution


Transitions: A/G, C/T

Transversions: A/T, A/C, G/T, C/G

Transitions (rate ) are much more likely than transversions (rate )


S(t) = s(t)r(t)s(t)u(t)



Wheres(t) = ¼ (1 – e-4t)

u(t) = ¼ (1 + e-4t – e-2(+)t)

r(t) = 1 – 2s(t) – u(t)

Phylogeny and sequence comparison

Phylogeny and sequence comparison

Basic principles:

  • Degree of sequence difference is proportional to length of independent sequence evolution

  • Only use positions where alignment is pretty certain – avoid areas with (too many) gaps

Distance between two sequences

Distance between two sequences

Given sequences xi, xj,


dij = distance between the two sequences

One possible definition:

dij = fraction f of sites u where xi[u]  xj[u]

Better model (Jukes-Cantor):

f = 3 s(t) = ¾ (1 – e-4t) 

¾ e-4t = ¾ – f  log (e-4t) = log (1 – 4/3 f)

 -4t = log(1 – 4/3 f)

dij = t = - ¼ -1 log(1 – 4/3 f)

A simple clustering method for building tree

A simple clustering method for building tree

UPGMA (unweighted pair group method using arithmetic averages)

Or the Average Linkage Method

Given two disjoint clusters Ci, Cj of sequences,


dij = ––––––––– {p Ci, q Cj}dpq

|Ci|  |Cj|

Claim that if Ck = Ci  Cj, then distance to another cluster Cl is:

dil |Ci| + djl |Cj|

dkl = ––––––––––––––

|Ci| + |Cj|


Ci,Cl dpq + Cj,Cl dpq

dkl = ––––––––––––––––

(|Ci| + |Cj|) |Cl|

|Ci|/(|Ci||Cl|) Ci,Cl dpq + |Cj|/(|Cj||Cl|) Cj,Cl dpq

= ––––––––––––––––––––––––––––––––––––

(|Ci| + |Cj|)

|Ci| dil + |Cj| djl

= –––––––––––––

(|Ci| + |Cj|)

Algorithm average linkage

Algorithm: Average Linkage




Assign each xi into its own cluster Ci

Define one leaf per sequence, height 0


Find two clusters Ci, Cj s.t. dij is min

Let Ck = Ci  Cj

Define node connecting Ci, Cj,

& place it at height dij/2

Delete Ci, Cj


When two clusters i, j remain,

place root at height dij/2




















Ultrametric distances and molecular clock

Ultrametric Distances and Molecular Clock


A distance function d(.,.) is ultrametric if for any three distances dij dik  dij, it is true that

dij dik = dij

The Molecular Clock:

The evolutionary distance between species x and y is 2 the Earth time to reach the nearest common ancestor

That is, the molecular clock has constant rate in all species

The molecular clock results in ultrametric distances







Ultrametric distances average linkage

Ultrametric Distances & Average Linkage

Average Linkage is guaranteed to reconstruct correctly a binary tree with ultrametric distances

Proof: Exercise






Weakness of average linkage

Weakness of Average Linkage

Molecular clock: all species evolve at the same rate (Earth time)

However, certain species (e.g., mouse, rat) evolve much faster

Example where UPGMA messes up:

AL tree

Correct tree









Additive distances


Additive Distances


Given a tree, a distance measure is additive if the distance between any pair of leaves is the sum of lengths of edges connecting them

Given a tree T & additive distances dij, can uniquely reconstruct edge lengths:

  • Find two neighboring leaves i, j, with common parent k

  • Place parent node k at distance dkm = ½ (dim + djm – dij) from any node m













Reconstructing additive distances given t

Reconstructing Additive Distances Given T















If we know T and D, but do not know the length of each leaf, we can reconstruct those lengths

Reconstructing additive distances given t1

Reconstructing Additive Distances Given T








Reconstructing additive distances given t2

Reconstructing Additive Distances Given T










dax = ½ (dvx + dwx – dvw)

day = ½ (dvy + dwy – dvw)

daz = ½ (dvz + dwz – dvw)

Reconstructing additive distances given t3

Reconstructing Additive Distances Given T


















d(a, c) = 3

d(b, c) = d(a, b) – d(a, c) = 3

d(c, z) = d(a, z) – d(a, c) = 7

d(b, x) = d(a, x) – d(a, b) = 5

d(b, y) = d(a, y) – d(a, b) = 4

d(a, w) = d(z, w) – d(a, z) = 4

d(a, v) = d(z, v) – d(a, z) = 6




Neighbor joining


  • Guaranteed to produce the correct tree if distance is additive

  • May produce a good tree even when distance is not additive

    Step 1: Finding neighboring leaves


    Dij = dij – (ri + rj)



    ri = –––––k dik

    |L| - 2

    Claim: The above “magic trick” ensures that Dij is minimal iffi, j are neighbors

    Proof: Very technical, please read Durbin et al.!










Algorithm neighbor joining

Algorithm: Neighbor-joining


Define T to be the set of leaf nodes, one per sequence

Let L = T


Pick i, j s.t. Dij is minimal

Define a new node k, and set dkm = ½ (dim + djm – dij) for all m  L

Add k to T, with edges of lengths dik = ½ (dij + ri – rj)

Remove i, j from L;

Add k to L


When L consists of two nodes, i, j, and the edge between them of length dij

Parsimony what if we don t have distances

Parsimony – What if we don’t have distances

  • One of the most popular methods:

    • GIVEN multiple alignment

    • FIND tree & history of substitutions explaining alignment


      Find the tree that explains the observed sequences with a minimal number of substitutions

      Two computational subproblems:

  • Find the parsimony cost of a given tree (easy)

  • Search through all tree topologies (hard)




Final cost C = 1


{A, B}











Parsimony scoring

Parsimony Scoring

Given a tree, and an alignment column u

Label internal nodes to minimize the number of required substitutions


Set cost C = 0; k = 2N – 1


If k is a leaf, set Rk = { xk[u] }

If k is not a leaf,

Let i, j be the daughter nodes;

Set Rk = Ri Rj if intersection is nonempty

Set Rk = Ri  Rj, and C += 1, if intersection is empty


Minimal cost of tree for column u, = C


























Probabilistic methods

Probabilistic Methods

A more refined measure of evolution along a tree than parsimony

P(x1, x2, xroot | t1, t2) = P(xroot) P(x1 | t1, xroot) P(x2 | t2, xroot)

If we use Jukes-Cantor, for example, and x1 = xroot = A, x2 = C, t1 = t2 = 1,

= pA¼(1 + 3e-4α) ¼(1 – e-4α) = (¼)3(1 + 3e-4α)(1 – e-4α)






Probabilistic methods1

Probabilistic Methods


  • If we know all internal labels xu,

    P(x1, x2, …, xN, xN+1, …, x2N-1 | T, t) = P(xroot)jrootP(xj | xparent(j), tj, parent(j))

  • Usually we don’t know the internal labels, therefore

    P(x1, x2, …, xN | T, t) = xN+1 xN+2 … x2N-1P(x1, x2, …, x2N-1 | T, t)





Felsenstein s likelihood algorithm

Felsenstein’s Likelihood Algorithm

Let P(Lk | a) denote the prob.

of all the leaves below node k,

given that the residue at k is a

To calculate P(x1, x2, …, xN | T, t)


Set k = 2N – 1

Iteration: Compute P(Lk | a) for all a  

If k is a leaf node:

Set P(Lk | a) = 1(a = xk)

If k is not a leaf node:

1. Compute P(Li | b), P(Lj | b) for all b, for daughter nodes i, j

2. Set P(Lk | a) = b,c P(b | a, ti) P(Li | b) P(c | a, tj) P(Lj | c)


Likelihood at this column = P(x1, x2, …, xN | T, t) = aP(L2N-1 | a)P(a)

Probabilistic methods2

Probabilistic Methods

Given M (ungapped) alignment columns of N sequences,

  • Define likelihood of a tree:

    L(T, t) = P(Data | T, t) = m=1…M P(x1m, …, xnm, T, t)

    Maximum Likelihood Reconstruction:

  • Given data X = (xij), find a topology T and length vector t that maximize likelihood L(T, t)

Current popular methods

Current popular methods

HUNDREDS of programs available!


Some recommended programs:

  • Discrete—Parsimony-based

    • Rec-1-DCM3


      Tandy Warnow and colleagues

  • Probabilistic

    • SEMPHY


      Nir Friedman and colleagues

  • Login