Translation
Download
1 / 16

Translation - PowerPoint PPT Presentation


  • 59 Views
  • Uploaded on

Translation. Need message mRNA Need translator molecule tRNA Need site ribosome rRNA + protein. tRNA. transcribed from DNA binds to other nucleic acids binds to amino acids. Charging of tRNA. attaching amino acid to 3’ end requires specific enzyme requires energy.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Translation' - kelsie-guthrie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Translation
Translation

  • Need message

    • mRNA

  • Need translator molecule

    • tRNA

  • Need site

    • ribosome

      • rRNA + protein


tRNA

  • transcribed from DNA

  • binds to other nucleic acids

  • binds to amino acids


Charging of trna
Charging of tRNA

  • attaching amino acid to 3’ end

  • requires specific enzyme

  • requires energy

aminoacyl tRNA:


The genetic code
The Genetic Code

  • Non-overlapping

    • one base belongs to one codon only

    • every three bases “read” as one codon

  • No “punctuation”

    • no bases skipped

  • Special start and stop codons

    • AUG = start signal

    • UGA, UAA, UAG = stop signals


Reading frames
Reading Frames

5’

C C G U A U G C G G A A C U C C A U G G G A A G

First amino acid in any polypeptide chain is

methionine (formylmethionine – prokaryotes)


Ribosome
Ribosome

A = aminoacyl site

P = peptidyl site

Small subunit

P

A

Large subunit

P = “donor” site

A = “entry” site

(E = “exit” site)


P

A

5


5’

CAGGAAGCGAUGGGCUCGACAUGCGA…

Shine-Dalgarno Sequence (prokaryotes) or

Scanning Hypothesis (eukaryotes)


UAC

UAC

met

met

5’

AUG


CCG

CCG

gly

gly

5’

GGC

AUG

UAC

met

|

met


AGC

AGC

ser

ser

AUG GGC UCG

CCG

gly

met

gly

met


UGU

UGU

thr

thr

AUG GGC UCG ACA

AGC

ser

gly

met

ser

glu

met


ACA UGA

UGU

Release factors

thr

ser

glu

met


ACA UGA

UGU

Release factors

thr

ser

glu

met


ACA UGA

Release factors

UGU

thr

ser

glu

met


thr

ser

glu

met


ad