1 / 21

Biology Assessment I -- review

Biology Assessment I -- review. What is “Active Transport?” Is energy required? If so, where does it come from?. What does this diagram show? . What are the sequence of steps? Where does this occur (be specific)? What are the cell parts involved?.

kagami
Download Presentation

Biology Assessment I -- review

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Biology Assessment I --review

  2. What is “Active Transport?” Is energy required? If so, where does it come from?

  3. What does this diagram show? • What are the sequence of steps? • Where does this occur (be specific)? • What are the cell parts involved?

  4. The DNA of embryonic stem cells can make any protein the organism needs. • Why don’t liver cells make nerve cell proteins?

  5. What would cause the wrong amino acid to be specified during protein synthesis? • Could that stop protein synthesis too soon? What do we call the DNA sequences that specify each amino acid in a protein? Could this cause an inherited genetic disease?

  6. What does this picture represent? • What does the real thing do?

  7. What is the Golgi apparatus? • What does it do? • Where is it found?

  8. Can you name the four differences between Eukaryotic and Prokaryotic cells? • One difference is a structure. • Which difference is that?

  9. This diagram shows the Calvin cycle. • What is going in? • What is coming out?

  10. What does a chain of amino acids linked together form? • If each amino acid is a “monomer,” what do we call several linked together?

  11. What kind of molecules are enzymes? • What other activities is that family of molecules involved with?

  12. What is a “codon?” • In the “translation” part of protein synthesis, what does a codon bind to? • What is the overall molecule called? • What does that molecule carry?

  13. This cartoon represents “peer review” of a science study. • What does it mean to you? • Compare to other types of reviews, such as a paid announcer or someone from a rights group.

  14. What does this diagram show? • “Hypotonic” means what? Define the other words.

  15. Enzymes “denature” (don’t function) under certain conditions. • Amylase denatures when it is too hot. What is the best temperature for amylase activity? • Is this greater or less than room temperature?

  16. What are the chemical parts of this molecule? • What is the molecule? • Where is it found?

  17. Watson and Crick found that each sequence of three bases on the “unzipped” DNA strand coded for a given amino acid, after being translated into RNA.

  18. If you substitute letters for the amino acids found by Watson and Crick, you can create a code table.

  19. Look at the following table and the encoded message. Decode the message. What does it say? Remember, if your “reading frame” is off, then the codons will not be correct and you will have a mutation. Note that “Uracil” replaces Thymine in RNA. The other bases are the same as in DNA.

  20. CUUGCACAUAUAGUCUACGCAUUACUUAUUCACAUACAUAUCUGCGAAGUG

  21. What is this cell organelle? What does it do?

More Related