1 / 18

The UCSC Genome Browser

The UCSC Genome Browser. From Men to Mice. WJ Kent, C Sugnet, T Furey, T Pringle, M Schwartz, R Baertsch, R Weber, K Roskin, D Thomas, S Rogic, M Diekhans, F Hsu, D Karolchik, D Haussler. Cardiac Troponin T2. Comparative Genomics at BMP10. Normalized eScores. Mouse/Human Synteny.

joan-craft
Download Presentation

The UCSC Genome Browser

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The UCSC Genome Browser From Men to Mice WJ Kent, C Sugnet, T Furey, T Pringle, M Schwartz, R Baertsch, R Weber, K Roskin, D Thomas, S Rogic, M Diekhans, F Hsu, D Karolchik, D Haussler

  2. Cardiac Troponin T2

  3. Comparative Genomics at BMP10

  4. Normalized eScores

  5. Mouse/Human Synteny

  6. Track Options & Filters Mini-buttons bring up track options such as those for spliced EST track below.

  7. Which EST to Sequence?

  8. MGC ESTS Drawn in Red

  9. DNA Coloring

  10. Coloring CRYGD Start gctcgttcaggggtaaaggtgtattctagatCCACAACAAGCCCCGTGGTCTAGCACAGC AAAGAGAAAAAAAGAGAACACGAAAATGCCCTTGCTCCCCTCCGGGGGCCCCTTTTGTGC GGTTCTTGCCAACGCAGCAGCCCTCCTGCTATATAGCCCGCCGCGCCgCAGCCCCACCCG CTCAGCGCCGCCGCCCCACCAGCTCAGCACCGCCGTGCGCCCAGCCAGCCATGGGGAAGG TGAGCCCAGCCTGCGCCCCGGGACCCCGGAGCTTCCTCCATCGCGGGGGCCAGAGACTGG GGCAGGAGCAGGCCTGTGAGACCTCGCCTTGTCCCGCCTTGCCTTGCAGATCACCCTCTA CGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGCAGCGACCACCCCAACCTGCA GCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGCGGCTGCTGGATGCTCTATGA GCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGCGGCGACTATGCCGACCACCA GCAGTGGATGGGCCTCAGCGACTCGGTCCGCTCCTGCCGCCTCATCCCCCACGTGAGTAC ATCCTCAAGTCAGGACCCAGGCCCTCAGGACACTCACTGGAtgGTTTCAAGCAAAAGTTA AACATTAGAAGTAGTGATCAGTcacaataaCTGAGAGTGGACAAAAGATGAACTATAGTG GATTAAGTCAATAGagttTGCTCCCCACATAAGCAAAGTATTACCCAGACAcCAGTTAAT caCAATTAATCCACAAATATGTATTGAGTAGGAATGTGTCTCCTGCCctAGGGGTTGTAT

  11. Gene Expression Tracks

  12. Alt Splicing Tracks

  13. Complex Transcription

  14. Add Your Own Tracks • Users can extend the browser with their own tracks. • User tracks can be private or public. • No programming required. • GFF, GTF, PSL or BED formats supported #chrom start end [name strand score] chr1 1302347 1302357 SP1 + 800 chr1 1504778 1504787 SP2 — 980

  15. The Underlying Database • Power users and bioinformaticians sometimes want underlying database. • There is a table for each track. • Larger tracks have a table for each chromosome. • Format of a track table generally similar to add-your-own track formats. • Pieces of database available from ‘tables’ browser. • Whole database available as tab-separated files.

  16. Parasol and Kilo Cluster • UCSC cluster has 1000 CPUs running Linux • 1,000,000 BLASTZ jobs in 25 hours for mouse/human alignment • We wrote Parasol job scheduler to keep up. • Very fast and free. • Jobs are organized into batches. • Error checking at job and at batch level.

  17. Acknowledgements NHGRI, The Wellcome Trust, HHMI, NCI, and Taxpayers in the US and worldwide. Whitehead, Sanger, Wash U, Baylor, Stanford, DOE, and the international sequencing centers. NCBI, Penn State, Ensembl, Genoscope, The SNP Consortium, UC Berkeley, LBL, LLL, Riken, The Mammalian Gene Collection, Softberry, IMIM, Affymetrix, Perlagen, Rosetta, the Mouse Homology Group The thousands of people who worked on the sequence and annotations

More Related