1 / 61

Gene - Sequence of Bases in DNA

Gene - Sequence of Bases in DNA. 5’ ATGCCTGCACATGTTAGC 3’ 3’ TACGGACGTGTACAATCG 5’ Specifies information about particular trait Cellular phenotypes controlled by _ ?. Generally Gene Protein Trait. 1. Evidence that genes code for enzymes .

gaenor
Download Presentation

Gene - Sequence of Bases in DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Gene - Sequence of Bases in DNA 5’ ATGCCTGCACATGTTAGC 3’ 3’ TACGGACGTGTACAATCG 5’ Specifies information about particular trait Cellular phenotypes controlled by _ ? Generally Gene Protein Trait 1

  2. Evidence that genes code for enzymes Garrod (1902) - ‘Inborn Errors of Metabolism’ Albinism - lack of pigmentation, melanin Lack: tyrosinase

  3. Evidence that genes code for enzymes PKU (phenylketonuria) - accumulation of phenylpyruvic acid Lack: phenylalanine hydroxylase Mental retardation, seizures, fair skin, light sensitivity, musty odor 3

  4. Evidence that genes code for enzymes Alkaptonuria - excrete homogentisic acid in urine (black) Lack: homogentisic acid oxidase Buildup of dark pigment in connective tissue 4

  5. Biochemical Pathways Gene 1 Gene 2 Gene 3 Enzyme 1 Enzyme 2 Enzyme 3 A B C D Blocked if Enz 2 nonfunctional Consequences??? 5

  6. Evidence that genes code for enzymes Phenylalanine hydroxylase Tyrosinase Homogentisic acid oxidase 6

  7. Tay-Sachs Disease Symptoms: blind, deaf, unable to swallow, muscle atrophy, paralysis High incidence: East European and Ashkenazi Jews 7

  8. Human Genetic Diseases - Table 4.2 8

  9. Beadle & Tatum - 1941 Neurospora crassa Select auxotrophs that don’t grow on MEM Determine AA required 9

  10. One-Gene-One-Enzyme Hypothesis 10

  11. Genetic Analysis of Biochemical Pathways 11

  12. Determining Order of Intermediates What is the order of intermediates? At which step is each mutant defective? Precursor C A D B F 3 5 2 4 1 12

  13. Conclusions from Beadle & Tatum’s Work One gene controls (encodes) one protein or polypeptide subunit or functional RNA (tRNA, rRNA, snRNA, miRNA) 13

  14. Sickle Cell Anemia Defective Hemoglobin structure Symptoms: fragile inflexible blood cells, anemia, blockage heart failure, pneumonia, paralysis, kidney failure, abdominal pain, rheumatism African American - 1 in 500 affected, 1 in 12 are carriers Hispanic - 1 in 1,000 - 1,400 affected; Caucasian - rare 14

  15. Mutations Responsible for Sickle Cell Anemia 15

  16. Examples of Hemoglobin Mutations Many changes have only slight effects Hb-C - mild anemia 16

  17. Cystic Fibrosis Defect: CF transmembrane conductance regulator chloride transport across membranes of some cells Caucasians: Incidence - 1 in 2000; Carriers - 1 in 23 Symptoms: pancreatic, pulmonary, digestive dysfunction Life expectancy ~ 40 years 17

  18. How does a gene encode a protein? DNA 5’ ATGCTAGTACTGATGCAGTCTGACTAC 3’ Polypeptide amino - Phe - Arg - Pro - Lys - Thr - Ala - Cys - carboxyl 18

  19. Twenty common amino acids: protein subunits Amino Acid Structure H H O H - N - C - C - OH R amino carboxylic group acid group 19

  20. Protein Structure Primary Structure Secondary Tertiary Quaternary 20

  21. Transfer of Information: Central Dogma DNA RNA Polypeptide transcription translation genes mRNA rRNA tRNA snRNA miRNA 5’ CCT 3 ’ 5’ CCU 3’ Pro 3’ GGA 5’ three bases (one codon) specify one amino acid 21

  22. Transcription: DNA - RNA RNA polymerase Promoter Initiation start site Template Strand RNA-like Strand (non-template) 22

  23. RNA Polymerase Activity Unwinding & Synthesis 5’ nucleotide triphosphate 23

  24. Gene Sequences Important in Transcription Promoter - interacts with RNA polymerase, indicates start site E. coli - consensus sequences -35 (TTGACA) -10 (TATAAT) Initiation Site of Coding Sequence - Termination Sequences - Upstream (-) Downstream (+) 24

  25. Initiation of Transcription (prokaryotes) RNA polymerase holoenzyme core enzyme - 2  , 1  , 1 ’ sigma factor -  binds -35 then -10 25

  26. Transcription Elongation and Termination RNA polymerase - unwinds and rewinds DNA - proofreading Terminator sequences Rho-dependent - protein involved in E. coli Rho-independent - RNA polymerase terminates itself 26

  27. Transcription in Eukaryotes RNA polymerases - ~ 12 subunits pol I - rRNA (28S, 18S, 5.8S) pol II - mRNA, snRNA pol III - tRNA, 5S rRNA, snRNA Promoter elements Core Inr - sequence spans +1 TATA box - at ~ -30 indicate start site Proximal CAAT box (~ -75) GC box (~ -90) enhancetranscription Enhancers - upstream or downstream of ORF 27

  28. Transcription Initiation in Eukaryotes General transcription factors (GTFs) required to start transcription 28

  29. Products of Transcription RNA processing in Eukaryotes 29

  30. Processing mRNA in Eukaryotes 7-methyl guanosine 5’ capping Nuclease protection Ribosome binding 30

  31. Processing mRNA in Eukaryotes 3’ Poly A tail transport protection Poly(A) site Poly(A) polymerase 31

  32. Processing mRNA in Eukaryotes RNA Splicing 32

  33. Processing mRNA in Eukaryotes Intron removal by spliceosomes - snRNPs (small nuclear ribonucleoprotein particles) 33

  34. Processing mRNA in Eukaryotes Self- Splicing Introns Ribozymes 34

  35. Translation messenger RNA protein Requirements: mature mRNA - instructions charged tRNAs - bring amino acids ribosome - workbench initiation, elongation, termination factors 35

  36. Transfer RNAs - products of several genes tRNA Anticodon 3’ end 36

  37. Charging of tRNA Aminoacyl tRNA synthetases - attach amino acid to 3’ end Charged tRNA carries aa to ribosome Anticodon binds complementary codon in mRNA 37

  38. Ribosomal RNA - rRNA E. coli ribosome - 70S 50S - 23S rRNA, 5S rRNA, 34 proteins 30S - 16S rRNA, 20 proteins Mammalian ribosome 38

  39. tRNA Landing Sites E (exit) P (peptide) A (aa) 39

  40. Ribosome Binding Site (RBS) for mRNA Prokaryotes - 16 S rRNA binds mRNA - ~ 8-12 nucleotides upstream of start consensus 40

  41. Ribosome Binding Site (RBS) for mRNA Eukaryotes Initiation factor eIF-4F binds 5’ cap Other eIF proteins, 40S ribosome, initiator Met-tRNA move along mRNA scanning for start codon Start AUG embedded in Kozak sequence 41

  42. Initiator tRNAs Prokaryotes - formylmethionine (fMet) + initiator tRNA O H H O H - C - N - C - C - O - tRNA R fMet - tRNA (fMet) Eukaryotyes - special initiator tRNAs 42

  43. Initiation of Translation 43

  44. Elongation during Translation 44

  45. Elongation during Translation 2 3 Peptidyl transferase A site 45

  46. Peptide Bond Formation Peptidyl transferase 46

  47. Elongation during Translation 3 4 translocation 5’ toward 3’ 47

  48. Elongation during Translation 5 6 next tRNA binds Elongation continues until stop codon 48

  49. Termination of Translation Stop codons: UAG, UAA, UGA Release or Termination Factors (RF) 49

  50. Overview of Translation Colinearity of mRNA codons and amino acids in polypeptide 50

More Related