Biotechnology - PowerPoint PPT Presentation

Biotechnology l.jpg
Download
1 / 59

Biotechnology. bios = life technos = tool logos = study of Biotechnology = The Study of Living Tools. 1. Timeline. 4000 BCEgyptians use yeasts for bread and wine 1750 BCSumerians brew beer 1500 ADAztecs make cakes from Spirulina algae 1917Biotechnology term coined

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Biotechnology

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Biotechnology l.jpg

Biotechnology

bios = lifetechnos = toollogos = study of

Biotechnology = The Study of Living Tools


1 timeline l.jpg

1. Timeline

  • 4000 BCEgyptians use yeasts for bread and wine

  • 1750 BCSumerians brew beer

  • 1500 ADAztecs make cakes from Spirulina algae

  • 1917Biotechnology term coined

  • 1972Hamilton Smith discovers first restriction enzyme

  • 1973Stanley Cohen made first transgenic organism with gene from African clawed toad into bacteria

  • 1978Louise Brown, first test tube baby born

  • 1981PCR Invented by Kary Mullis

    Genentech releases (Humulin) human insulin

  • 1984PCR used by Alec Jeffries in DNA fingerprinting

    EPA approves release of genetically engineered tobacco

  • 1990Pfizer introduces Chymosin (Rennin)

  • Michael Crichton’s Jurassic Park published

  • 1993FDA approval of Monsanto’s rBGH/rBST

  • 1994Calgene introduces Flavr-Savr Tomato

  • 1995O.J. Simpson Trial

  • 1996Sequence completed for S. cervisiae

  • 1997Cloning of Dolly at Roslin Institute

  • 1998First animal genome sequenced: C. elegans

    James Thompson (UW-Madison) develops procedure for culturing stem cells

    40 million hectares of GM crops planted globally (soy, cotton, canola, corn)

  • 1999‘Golden Rice’ developed

  • 2000First Plant Genome Sequenced – Arabidopsis thaliana

  • 2001Drosophila genome published

    First cloned cat – “carbon copy”

  • 2003Completion of Human Genome Project

  • 2005Rice Genome Sequenced

  • 2007GM meat approved for use


Selective breeding l.jpg

Selective Breeding

a. Luther Burbank

  • disease resistant Burbank potato

  • fight blight, etc in Ireland

    b. Norman Borlaug of International Maize &

    Wheat Research Center in Mexico

    (received Nobel Prize)

  • Crossed short-stemmed wheat with

    Mexico’s best wheat

  • Gov’t of India requested seeds,

    as tall wheat plants falling over

  • Increased wheat production from 12 million metric tons in 1965, to 20 million in 1970, 37 million in 1982

    c. Hybridization

  • Dissimilar individuals mate to hope to get desired traits

  • Burbank: Popular Shasta Daisies

    d. Inbreeding

  • Keep desired traits

  • Brings recessive traits too (joints in golden retrievers)


Increasing variation l.jpg

Increasing Variation

a. Inducing mutations in bacteria

  • Radiation, chemicals, r-strategists

  • Can clean up oil spills (bioremediation)

    b. Polyploidy (extra chromosomes)

  • Usually fatal in animals

  • Bigger, stronger, sexier plants (bananas, citrus fruits, day lilies)


Dna manipulation l.jpg

DNA Manipulation

1. Cutting & Separating

a. Restriction Enzymes

  • Proteins from bacteria that cut DNA at specific points

    • Cut at palindromes

    • Evolved as viral defenses

  • Can have blunt or sticky ends

  • Can be spliced into DNA cut with same RE

Naming of EcoR1:

Efrom genus of organism where found (Escheria)

cofirst 2 letters of species name (coli)

RStrain (RY13)

1Order discovered


Restriction enzymes l.jpg

Restriction Enzymes


Cutting separating cont d l.jpg

(Cutting & Separating, Cont’d)

b. Gel Electrophoresis

  • Migration of charged particles under electric field

  • DNA has negatively charged phosphate ends

  • (-) electrode repels DNA, (+) electrode attracts DNA

  • 1% agarose gel (natural colloid from seaweed)

    • agarose is convoluted – like a sieve

    • TBE solution is electrolytic solution

  • Migration of DNA molecules move through gel at different rates (bigger = slower, smaller = faster)

  • DNA is stained to see bands (Ethidium Bromide)

  • Usually a marker is used (of known fragment sizes)


Equipment l.jpg

Equipment


Digest separation l.jpg

Digest & Separation


Cutting separating cont d11 l.jpg

(Cutting & Separating, Cont’d)

c. Restriction Mapping

  • Use of various restriction enzymes

  • Gel digests show size of fragments

  • Patterns of digests can create restriction map

  • pUK 1 plasmid:

Gel DigestRestriction Map


Slide12 l.jpg

  • Restriction digest of plasmid DNA from Escherichia coli

  • run on a 1% agarose gel and stained with ethidium bromide

    • Lane 1 (far left) is a kilobase DNA ladder

    • Lane 2 is the uncut plasmid DNA

    • Lane 3 is a single digestion of the plasmid with the EcoRI

    • Lane 4 is also a single digestion, but with XhoI

    • Lane 5 (far right) is a double digestion - both EcoRI and XhoI


Dna manipulation cont d l.jpg

DNA Manipulation, Cont’d

2. Identifying Genes - Southern Blot (named after Ed Southern)

a. DNA cut with RE’s

b. Separated by Gel Electrophoresis

c. DNA “blotted” to filter paper and probe is added

d. Only DNA fragments with identified gene bind to probe


Southern blot l.jpg

Southern Blot


Dna manipulation cont d16 l.jpg

DNA Manipulation, Cont’d

3. Nucleotide Sequencing (fluorescent dye-terminator cycle sequencing)

a. Unknown Single Stranded DNA put in test tube

b. DNA polymerase and nucleotide bases (dNTP’s) added

c. Small number of bases with flourescent dye attached (ddNTP’s)

d. Each time dye-labeled nucleotide binds to fragment, synthesis stops

e. Ultimately yields DNA strands of different lengths

f. Separated (by gel electrophoresis)

g. Color of bands tells sequence (read by laser detector, computer software analyzes)


Laser readout l.jpg

Laser Readout


Abi prism l.jpg

ABI Prism


Dna manipulation cont d21 l.jpg

DNA Manipulation, Cont’d

4. Making Copies (Polymerase Chain Reaction or PCR)

a. Small amount of double stranded DNA

b. Heated to separate, then cooled

c. Add DNA polymerase*, primers (short pieces of artificial DNA), and free nucleotides

  • *Taq polymerase (from Thermophilus aquaticus)

  • Isolated from hot springs in Yellowstone

  • Can withstand hot temperatures

    d. DNA poly attaches nucleotides to primers

    e. REPEATED many times (5 minute cycles)

    f. Use of a thermal cycler


Dna manipulation cont d24 l.jpg

DNA Manipulation, Cont’d

5. Recombinant DNA

a. Use RE’s to cut out gene

b. Cut host DNA with same RE

c. Need a vector to incorporate into host

d. Screen for effective transfer

e. If successful, then results in Transgenic Organism

f. First done by Steven Howell by inserting luciferase gene (for glowing) from firefly into tobacco plant

g. Transgenic Organisms

1. Bacteria

  • Transformation with plasmid

  • Plasmid: ring of DNA used to transfer genes


Slide27 l.jpg

2. Plants

  • Bacterium

    • Has small DNA plasmid causes tumors

    • Inactivation of tumor gene

    • Insertion of foreign DNA

  • May uptake DNA if cell walls removed

  • Gene gun!

    3. Animals

  • Viral vectors


Slide28 l.jpg

4. Nuclear Transfer

  • Can inject DNA into large egg nuclei

  • Enzymes used to repair and recombine DNA in cell help insert foreign DNA


Slide29 l.jpg

5. Scientists may also insert marker gene to tell if procedure worked

  • ampicillin resistance (bacteria then grown on nutrient medium with ampicillin)

  • glowing gene from jellyfish (produces GFP)

To determine what turns on color in wings, University of Buffalo (NY) biologists inserted a marker gene from jellyfish into African butterflies resulting in fluorescent green eyes


Using glowing markers l.jpg

Using Glowing Markers

Fruit Fly Embryo

Glowing Tobacco!!


Slide31 l.jpg

6. Knockout Mice

  • Scientists transfer a defective version of a gene they want to study into stem cells

  • The defective gene “knocks out” the normal gene, and scientists can examine the effects of the disabled gene on the resulting young mouse.

  • Using gene targeting, researchers can transfer human disease genes into embryonic stem cells to make mouse models of many human ailments


Slide34 l.jpg

7. Whole Genome Analysis

  • Allows analysis of multiple genes in various conditions

  • “Complexity does not come from the number of genes, but from the way in which they are used” (Gerald Rubin, HHMI VP)

  • Gene Chips (Affymetrix)

    • ½ square inch glass with short DNA fragments

    • ~$200,000 each

  • Microarrayer

    • Robot designed by Patrick Brown @ Stanford

    • Can analyze 6,000 genes in yeast simultaneously

    • ‘Make your own’ for $25,000


Slide36 l.jpg

A Microarrayer Shows How Genes in a Yeast Cell Respond to Different Types of Stress

http://www.hhmi.org/genesweshare/a110.html


Us gov vs celera genomics l.jpg

US GOV vs. Celera Genomics


Slide39 l.jpg

Uses

1. Human Genome Project

a. Attempt to map all of human genome!

b. Begun in 1999, working draft Feb. 2001, finished 2003 (3 years ahead of schedule!)

c. Collaboration of 20 labs in 6 countries

d. Competition with Craig Ventnor, Celera Genomics

e. Discoveries

  • 3.2 billion base pairs

  • only 30-40,000 genes

  • over 120,000 unique mRNA molecules

  • only 1-1.5% of human DNA codes for proteins

    • Each cell has 6 ft of DNA = 1 inch of exons to be transcribed

    • Most of genome is “Junk DNA”

  • Genes not evenly distributed

    • Chromosome 19 packed with genes

    • Large chromosomes 4 & 8 have few transcribed genes


Types of genetic maps l.jpg

Types of Genetic Maps


Pglo plasmid map l.jpg

pGLO Plasmid Map


Slide42 l.jpg

pGLO Sequence

ATCGATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTGCAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCTAATTCTCATGTTTGACAGCTTATC


Slide45 l.jpg

2. DNA Fingerprinting

a. History

  • Lynda Mann in England

    • Raped and Murdered, Nov. 22, 1983

    • Local dishwasher questioned & pleads guilty to similar case

    • Alec Jeffries uses new method of PCR for identification, exonerates dishwasher of both crimes

    • Every man in area ‘fingerprinted’ by DNA, no matches

    • Colin Pitchfork finally caught and tested positive (friend went in to fake test for him)

  • Plant Witness

    • Murder case in Phoenix, Arizona

    • Pager found at crime scene led police to suspect (said that victim had robbed him)

    • Palo Verde pods in truck yielded DNA that matched with trees at crime scene


Slide46 l.jpg

b. Uses

  • Identification and exoneration of rapists, criminals

  • Paternity cases (Jefferson/Sally Hemmings)

  • Identification of body parts

    • Supposed heart of Louis XVIII (child king who died in prison) compared to hair from Marie Antoinette

    • ID of bodies in mass graves in Guatemala (from civil war)

  • Genetic testing (blood stain on Lincoln’s jacket tested for Marfan’s syndrome)

  • Migration patterns

  • ID tags for children, pets

  • ID of endangered/protected species

  • Food authentication, such as in wine and caviar

  • Authentication of official 2000 Summer Olympic goods (sections of DNA taken from several unnamed Australian athletes added to ink used to mark all items)


National geographic march 2006 l.jpg

National Geographic March 2006


Slide48 l.jpg

c. Use of RFLP’s (restriction fragment length polymorphisms)

  • Procedure

    • Restriction enzymes cut DNA differently

    • Fragments separated with GE

    • Probed and exposed to X-ray film

  • Screening for Sickle Cell Anemia

    • Point mutation of CAG (betaA gene) to CTG (betaS gene) = SNP or single nucleotide polymorphism

    • Produces valine instead of glutamic acid in hemoglobin molecule

    • RE’s cut DNA differently

      • Probe attaches to specific sequence

      • Affected = large fragment

    • Pedigree shows family; son with sickle-cell anemia

    • Electrophoresis pattern below each child


Slide49 l.jpg

RFLP


Slide50 l.jpg

d. DNA Typing

  • Small percentage of DNA different from person to person (less than 1/10th of 1%)

  • Variable regions used for comparison

Gel Lanes

MARKERS

VICTIM

EVIDENCE #1 (semen stain left on the victim's clothing)

EVIDENCE #2 (semen from the vagina of the rape victim)

SUSPECT #1

SUSPECT #2

CONTROL (check to see if probes are working)

  • Results

  • Suspect #2 can be clearly ruled out

  • Suspect #1 MAY be guilty (probability that 6 alleles match is 1 in 4056)

  • Suspects NOT picked at random: Evidence used in conjunction with

  • More probes (alleles) the better: 14 = chance of match is 1 in 268 million


Slide51 l.jpg

3. Transgenic Organisms

a. Medicine

1. Isolate gene for protein needed for medicine

2. Inserted into bacteria, will make protein in normal course of its life – cultured in bioreactor

Humulin (Human Insulin)


Genetically engineered medicines l.jpg

Genetically Engineered Medicines

  • ErythropoetinAnemia

  • Growth FactorsBurns, Ulcers

  • Human Growth

    Hormone (HGH)Dwarfism

  • InsulinDiabetes

  • InterferonsViral Infections, Cancer

  • TaxolOvarian Cancer


Slide54 l.jpg

3. Inserted into animals (livestock)

  • Dolly cloned in 1997 by Ian Wilmut in Scotland

  • Potential to produce protein in milk

  • Cloning done once, then livestock reproduce regularly to pass on gene = “FARMacy”


Slide55 l.jpg

b. Agriculture

1. Improving crops

  • Crops resistant to biodegradable weedkiller (glyphosate)

    • Kills only weeds

    • Half of 72 million acres of Soybeans in 2000

  • Flavr-Savr tomato last longer

  • Genetically enhanced rice with more Vitamin A


Slide56 l.jpg

  • Concerns

    • Natural resistance to enhancement

    • ‘Jumping’ genes

    • Allergies

      2. Improving livestock: growth hormone added to cow (bGH/bST)

      c. Bioremediation - microorganisms engineered to feed on toxic or hazardous materials

      1. Pseudomonas bacteria engineered to degrade polyhalogentated compounds (pollutants)

      2. E. coli engineered to clean up mercury


Bioremediation cartoon l.jpg

Bioremediation Cartoon


4 rna interference rnai l.jpg

4. RNA interference (RNAi)

  • post-transcriptional gene silencing

  • double stranded RNA (dsRNA) causes sequence-specific degradation of homogolous mRNAsequences

  • First found in C. elegans


The future l.jpg

The Future?

  • Alternatives to antibiotics to protect livestock against bacterial infections

  • 2nd Gen of GM crops is expected that could eliminate of allergens in food, increase nutritional content, and lower fat and oil levels

  • 3rd Gen GM crops may have properties like salt tolerance, drought resistance, drugs and vaccines within them, and plastic starter chemicals to create bioplastics

    http://www.biotechnologyonline.gov.au/foodag/timeline.cfm


  • Login