Cross Vertebrate Genome Analysis of NRSF/REST-1 Subtitle: Chicken Run

1. Cross Vertebrate Genome Analysis of NRSF/REST-1 Subtitle: Chicken Run Timothy Ng SoCalBSI 2004 Caltech PI: Barbara Wold, Ph.D. Mentor: Ali Mortazavi

2. Outline: Objective: 1) test run Cistematic, 2) identify NRSF across genomes, 3) identify NRSF and putative regulated genes in chicken • What is NRSF, NRSE, REST? • What are zinc fingers? • Why cross-genome analysis? • Why chicken? • Why use NRSF as a model of study? • Methods: WGS vs Assembly, Species used, BLAST, T-coffee, Cistematic, Python APIs • Results: Neighbouring “Controlled” Genes? Annotation Issues: Emsembl vs. Cistematic vs. Genescan? • Discussion: Further studies wHaT? How? WhY?

3. NRSE (Neuron Restrictive Silencing Element) • consists of ~ 21 - 23 bp • found usually within 5’ UTRs and introns of neuronal genes • Experimentally found to be close to and regulating neuronal genes: NaChII, SCG10 • Silences gene through chromatin remodeling • In human and murine models, putative expression patterns known suggesting ~90% of NRSE sites regulate neuronal genes • Regulated genes tightly clustered, suggest coregulation

4. NRSF/REST-1 • 116-210-kDa glycoprotein • CDS contains nine zinc fingers, although splice-variants may contain less • zinc fingers allow binding of of protein to DNA • in vitro experiments support evidence for importance of zinc fingers 1-5 • shown to be active in non Neuronal cells and during neurogenesis • recruits associated protein coREST for large silencing over chromosomal interval • contains 2 repressor domains • NH2 and COOH domains interact with different factors

5. Repressor elements of NRSF of the N- and C- terminus associate with different corepressors

6. NRSF-directed gene Silencing

7. Why Chicken? • gives a better filter and understand of NRSF across vertebrates • assembly completed and annotated • small genome • Why NRSF? • extensively documented and tested in literature • well annotated for human and mouse • good model for gene regulation

8. Biological Significance • outside the CNS, repression of neuronal genes is required for maintaining the unique functions of the nervous system • given the size of the NRSE site and size of vertebrate genomes it is an excellent model of cell differentiation regulation since it is large enough to have low probability of stochastic appearance (~ 9.09^-13), in comparison most regulatory regions like NRSE have much smaller size lending to greater probability of random occurance in the genome, e.g. a hexamer has a probability of (2.44^-4)

9. Phylogeny A = assembly W = WGST N = NCBI Zebrafish (A) Macaque (W) Chicken (A) Rat (N) Human (A) Mouse (A) Dog (A) Chimp (A) Fugu (A) Cow (W)

10. Materials and Methods in detail: • begun with blasting known species in phylogeny • WGS highest scoring blasts compiled into one FASTA file for ClustalW and T-coffee analysis • to gain a more accurate picture of NRSF in evolution, motif finding with Chicken • maximum of 2 mismatches allowed due to combinatoric growth of possible motifs

11. T-coffee output T-coffee output Zinc finger start Zinc finger start

12. Cistematic chromList.append(('chicken','27')) chromList.append(('chicken','27rand')) #analysis from chromosome 27 exp = Locate("nrsf","nrsfG27.db") # creates database exp.initialize('chromosome', chromList) prog = Locator() prog.setConsensus('KKCAGCACCNHGGACAGMRSC') #21bp Motif, NRSE prog.setID('NRSF') exp.appendProgram(prog) exp.run() #First Cistematic is run assuming no mismatches on chromosome 27 exp.createAnalysis() exp.loadAnalysis('chr27.0') exp.mapConsensus() exp.mapNeighbors(15000) #sets neighbour gene range to 15,000 bp exp.saveMotifNeighbors('nrsf.0.tab') #summarises all annotation exp.summarizeMotifs('nrsf.0.motsum') #summary of motif hits and loci exp.summarizeMotifNeighbors('nrsf.0.neisum') #summary of how many motifs have neigbbouring genes exp.saveAnalysis()

13. exp.mapNeighbors(15000) #sets neighbour gene range to 15,000 bp 15,000 bp 15,000 bp ? ? NRSE Motif Found

14. Sample output Computer:~/cistematic_examples/chr27 labtimng$ more nrsf.1.tab 1-LOC-NRSF 1 chicken 27rand 2829 R 8903 26652 R chicken 48776 GGCAGCACCCAGGGCAGCACC ENSGALG00000002765.1 Found on Chr27 1 mismatch Motif Loci Motif Match Ensembl Accession

15. Results: • chicken genome is 1/3 of human, ~ 1,000,000,00 bp • chicken motif hits for 0, 1, 2 mismatch respective: 60, 219, 1178 • human motif hits: 97, 545, 2608 • note chicken has 1/2 the motif hits of human, yet 1/3 the size of human

16. Results cont • all described neighbouring genes in chicken have some neuronal function from GABA to LIM, e.g. chromosome 1 and 4 both contain genes for fibroblast growth • most genes are however undescribed • furthermore, results from GeneScan and Ensembl are occasionally contradictory • chicken also contained small mini-chromosomes that resemble cosmids which were lumped into the category of ChrUn, Chromosome Unknown

17. Discussion • all matches in chicken study were restricted to the a threshold of 90% identity • chicken also lacks olfactory genes, possibly accounts for less regulated genes relative to human • however, due to insufficient annotation it is difficult to ascertain how many of those neighbours are real genes, neuronal genes and whether or not Cistematic skipped over real but unknown/undiscovered genes

18. Future Work • blasting/blating undescribed sequences versus human or mouse may aid in discovering gene identity • protocol may be repeated on other assemblies such as the newly released dog • constructing a phylogeny of NRSF across vertebrates • determining how crucial deletions or insertions are in NRSF across genomes • discriminating between biologically significant versus nonsense

19. Acknowledgements I would like to thank my mentor Ali Mortazavi, the Caltech tech gurus Joe Roden, Diane Trout, Brandon King and my fellow Caltech intern Deanna Mendez for all their help, assistance and support Dr. Barbara Wold for letting me into her lab Dr. Jamil Momand, Dr. Nancy Warter-Perez, Dr. Wendie Johnston, Dr. Sandra Sharp and Jacqueline Heras for all their hard work before, during and after the didactic period I would like to thank all my fellow interns for making this summer a BLAST I would finally like to thank NSF and NIH for their funding and support

20. References: Lunyak V. et al. Corepressor-Dependent Silencing of Chromosomal Regions Enconding Neuronal Genes. Science Vol 298 2002. Pg 1747-1752 Lunyak V. et al. REST and peace for the neuronal-specific transcription program. ANN NY ACAD SCI 1014: 110-120 2004 Murai K. et al. Direct interaction of NRSF with TBP: chromatin reorganization and core promoter repression for neuron-specific gene transcription Nucleic Acids Research Vol 32 2004 pg 3180-3189 Schoenherr C.J., Paquette A.J. & Anderson D.J. Identification of potential target genes for neuron-restrictive silencer factor. PNAS Vol 93 1996 pg 9881-9886 Shimojo M, Lee J.H & Hersh L.B. Role of Zinc Finger Domains of the Transcripction Factor Neronal-restrictive Silencer Factor/Repressor Element-1 Silencing Transcription Factor in DNA Binding and Nuclear Localization. J Biol Chem Vol 276 2001 pg 13121-13126 Shimojo M & Hersh LB Regulation of the cholinergic gene locus by the repressor element-1 silencing transcription factor/neuron restrictive silencer factor (REST/NRSF) Life Sciences Vol 74 2004. Pg 2213-2225