140 likes | 298 Views
Population Genetics. Do Now: Tongue rolling (T) is dominant to not being able to roll (t). In a group of 20 people, 18 can roll their tongues, and 2 cannot. What % of people have the tongue rolling phenotype?
E N D
Population Genetics Do Now: Tongue rolling (T) is dominant to not being able to roll (t). In a group of 20 people, 18 can roll their tongues, and 2 cannot. What % of people have the tongue rolling phenotype? What is the minimum % of all of the alleles in the population that are recessive (t)?
Phenotype Frequency • Phenotype frequency is the % of individuals in a population (group of organisms of the same species) that have a certain phenotype. • 18/20 = 90%
Gene Pool • A gene pool is the complete set of all alleles found in all individuals in a population OO Oo Oo Gene Pool: 6 O 4 o oo OO
Allele Frequency • Allele frequency is a measurement of how common an allele is in a population. • P is typically used to represent the frequency of the dominant allele, and Q represents the recessive • PA = f(AA) + ½ f(Aa) • Qa = f(aa) + ½ f(Aa) • By definition, P + Q = 1
Allele Frequency Example • In a population of 100 humans, 90 are homozygous dominant for albinism (non-albino) • 8 are heterozygous • 2 are homozygous recessive • P = f(AA) + ½ f(Aa) = .90 + ½ (.08) = .94 • Q = f(aa) + ½ f(Aa) = .02 + ½ (.08) = .06 • Check • P + Q = 1… .94 + .06 = 1
Genome • A genome is all of the genetic information of an individual. • A genome includes both genes AND non-gene information (“junk” DNA) • The human genome is 3.2 billion bases long. • ATGCTTATGCTGGCTAGCTGCGCTATCGAT…
Genome Wars • We will be playing a game to simulate the effect of the environment on a population
You are a Prokaryote • Locked in a desperate struggle for survival…
Part 1: Make a genome • You will select 4 alleles to make up your genome. Each allele gives you a bonus in a specific environment…
Part 2: Determine Allele Frequencies • What does the gene pool look like?
Part 3: Evolve! • Extinctions, mutations, and environmental change… can your genome make it?
Review • What’s a genome? • Allele frequency? • Gene pool? • And what does the selecting in biology?