slide1
Download
Skip this Video
Download Presentation
Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs

Loading in 2 Seconds...

play fullscreen
1 / 9

Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs - PowerPoint PPT Presentation


  • 69 Views
  • Uploaded on

Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs. by: Alessia Fiore, Giulia Falcone ENEA, Casaccia Research Center, Rome. S teps. Choice of 12 sequenced BACs (1/chromosome) with good end sequences on SGN. PCR primer design on BAC ends.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs' - ardith


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Validation of a procedure for BAC

end mapping on

S. lycopersicum x pennellii ILs

by:

Alessia Fiore, Giulia Falcone

ENEA, Casaccia Research Center, Rome

slide2

Steps

Choice of 12 sequenced BACs (1/chromosome)

with good end sequences on SGN

PCR primer design on BAC ends

Amplification of S. lycopersicum and S. pennellii DNA

Amplification and sequencing of 72 ILs (single pass, SP6 end)

Polymorphism detection and mapping of SP6 end

Confirmation of T7 end on selected ILs

slide3

Primer design

>LE_HBa0051C14_SP6_end CTCATCAACAGCATTGTCAAGGAGCTCTGCCAAGGCTTTAGACATCACAGAACAACAATGGCTATGTTAACACTCCAGTAATAGCATTTGCAATAATCCTATTACCACACAATAATATGGAAACGAAAAATGAATCAGCAATAGCACATACCACCAAATGCCCACTTATGGGAAGTGGCGTTTGAGTGAAGGAACTTCGGGTGAATGTGCAAGAAACTGGAGCCTTCTGTATAATGCCACAAATAAGATGACAACATACATATTAGATGCAAAACACATACTTGAATTACAGATAAAGAATTAAGCTATAAGGCGATATAGAAAGGTAGGCAAAGAAAAGATTGACCAACTACTCAAAACATCAGCACGCATGGTTTATGCATGGTAATGTGTTTGCTAAGAACAATTTTGAAAAAAGGAAAAAATGGGTACTTCAGTGCATAATACTTTTAAGGGTGGACTTGGTAGCATGCCCCTCATCAAATTTCCAGCTTTCCAGAACTGGCGAGATAGGGGTGCTGGACATATTTGTGATGTAGAACATAGGCTTGAATCATCTATCGGAGACTGATCTTGATCCAAGACGGAAGTTCTACTCTGTTCAGTAGCTGTAGAATCTTGCCTCCCACAGCTGCTTGAGGATTTTTTATATGGCAAGGAATCAGCTTCACAGCACTCCATTTGTGGAATTAAACTTTCAACCAATATAGGTTCCAACTTAACAGTCTCTATCTCCCCACCTCCAAGATTGTTACTACACAAGCCAACCATATTTGT

Parameters:

  • End sequences > 500bp available on SGN
  • Amplification product @400bp
  • Primer length: 18-20bp

Selected BACS

slide4

Example of A->G mutation

on SP6 end

LE_HBa0051C14_SP6_lyc

LE_HBa0051C14_SP6_penn

slide5

Amplification of IL DNA

SP6 end ofLE_HBa0051C14:

M: 1Kb ladder, V: empty

slide6

Mapping of SP6 end

LE_HBa0006E18, SP6 end: maps to Ils 4.2, 4.3, 4.3.2

ad