1 / 35

Trumpet leaves and microRNA

Trumpet leaves and microRNA. Catherine Kidner CSHL. Patterning events happen very early in leaf development. Processes in leaf development. Down regulation of meristem-specific genes. Establishment of axis. Growth and cell differentiation. Stages of leaf development. Arabidopsis thaliana.

apollo
Download Presentation

Trumpet leaves and microRNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Trumpet leaves and microRNA Catherine Kidner CSHL

  2. Patterning events happen very early in leaf development

  3. Processes in leaf development Down regulation of meristem-specific genes Establishment of axis Growth and cell differentiation

  4. Stages of leaf development

  5. Arabidopsis thaliana flower silque (fruit) lateral shoot cauline leaf 5 Chromosomes 125 Mega bases of DNA First plant genome sequenced (2001) rosette leaf

  6. Patterning events happen very early in leaf development Trichome (hair) Interlocking epidermis Leaf blade expanding Petiole

  7. YABBY (FIL) KANADI STM PHB AS1 Genes involved in leaf development

  8. Mutations in ARGONAUTE1 Cause Developmental Defects Relative size Stem cell defects Organ identity defects Organ polarity defects

  9. Mapping Mutations in Arabidopsis

  10. Populations of Arabidopsis

  11. Two lab strains Landsberg Columbia Most ‘classical’ mutants Easiest to transform originally Compact, so easy to work with Most new insertion lines Easiest to transform now Full genome sequence

  12. catcgtcggggacttagatgtatatatatcgctgt Dde1 cttag catcgtcggggagttagatgtatatatatcgctgt CAPs markers exploit the variation between the two strains Ler Col-0

  13. Self F1 F2 Plants ago-12/ago1-12 +/+ CAPS mapping

  14. Wild type siblings ago-12 phenotype L/L L/L C/C L/L C/L C/L

  15. The Role of ARGONAUTE

  16. The ARGONAUTE family RG-rich PAZ PIWI RG-rich PIWI PAZ Piwi family AGO family

  17. An Allelic Series of ARGONAUTE1 Mutants Strong Medium Weak ago1-12 ago1-11 ago1-9 ago1-10 RG-rich PAZ PIWI RG-rich PAZ PIWI

  18. RISC AGO aaaa RNA interference Centromere function dsRNA siRNA Science 2002 Development PTGS Viral defense

  19. miRNA and the Role of AGO1 AGO1 CAF RISC 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa mRNA degradation

  20. AGO1 and Development

  21. 100ng 10ng 1ng 0.1ng ago1-10 ago1-10 ago1-10 ago1-10 WT WT WT WT Genes regulated by AGO1 Total RNA One Step RT-PCR ER No Change AS1 No Change Down in ago AG Down in ago AP1 Up in ago CLF Down in ago FIL KAN1 No Change

  22. ago1-11 ago1-11/ stm-2 ago1-11/ stm-2 AGO1 is required for stem cell function Strong alleles of AGO1 lack shoot apical meristems Weak alleles of STM enhance weak alleles of AGO1 ago1-10

  23. AGO1 is required for organ identity via UFO and LFY

  24. ago1-12

  25. ET2689 ET3964 WT ago WT ago WT ago WT ago ER FIL 100ng 10ng 1ng 0.1ng ago1 has Adaxialised Organs

  26. miRNA Regulation is Required for Stem Cells and Polarity Strong caf alleles are embryo lethal caf-1 (weak) ago1-11 (weak) caf/caf, ago1-11/ago1-11

  27. The HD-ZIP III gene PHABULOSA is Associated with Adaxial Cell Fate Phab1-D/+ WT McConnell et al., 1999, 2001

  28. 1kb HD-ZIP III Genes are Targets of miRNA homeo- domain START lipid-sterol binding domain leucine zipper * At REVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHABULOSA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHAVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At miRNA165 5’ CCGGACCAGGCTTCATCC 3’ At miRNA166 5’ CCGGACCAGGCTTCATCC 3’ Reinhard et al., Llave et al., Parks et al., 2002

  29. ago1-10 ago1-11 pnh PHABULOSA caf wt wt wt PHAVOLUTA REVOLUTA TUBULIN RUBISCO HD-ZIP III transcripts accumulate in PAZ mutants 10ng 30ng 60ng

  30. miR165 is Expressed Abaxially in Leaf Primordia miR165 PHB/PHV

  31. miR165 PHB/PHV miR165 is Over and Ectopically Expressed in ago1

  32. miR165 PHB/PHV AGO1 CAF 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa Adaxialised

  33. A Model for Leaf Development

  34. CSHL Plant Group

More Related