1 / 30

Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research

Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research. Michael Kamal Broad/MIT Center For Genome Reseach. A First Look at the Mouse Genome. Preliminary mouse genome analysis Future directions (briefly). Article available online:. http://www.nature.com/nature/mousegenome/.

aphrodite-stephenson
Download Presentation

Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research Michael Kamal Broad/MIT Center For Genome Reseach

  2. A First Look at the Mouse Genome • Preliminary mouse genome analysis • Future directions (briefly) Article available online: http://www.nature.com/nature/mousegenome/

  3. Mouse Genome Sequencing Consortium Whitehead Institute Washington University St Louis Sanger Institute EBI Draft BAC map x 6.5 x shotgun coverage x Genome Assembly x Finished sequence BAC-based coverage X Finishing C57BL/6J Female

  4. Mouse Genome Sequencing Consortium -41 M reads -2 and 4 kb plasmids (90%) -10 kb plasmids (5%) -40 kb fosmids (5%) -155 kb and 200 kb BACs (RPCI-23 & 24) -WI 54% of reads

  5. Assembly: 88 ultracontigs, covers 96% of genome Contig: 25 kb Super: 17 Mb Ultra: 50 Mb

  6. Regions of conserved synteny: ~95% of genome Extremely high conservation: 560,000 anchors

  7. Regions of conserved synteny: ~95% of genome

  8. Regions of conserved synteny: ~95% of genome

  9. Genome size: Mouse < Human (2.5 vs 2.9 Gb) Autosomes Chromosome X Expansion ratio (M/H)

  10. Less Transposon Activity in Mouse Lineage? Total Transposon-derived Repeat 46% Human 400 Mb Mouse 37% No!!!! More Transposon Activity Lineage-Specific Repeat Ancestral Repeat Human 100 Mb Mouse Genome size: Mouse < Human (2.5 vs 2.9 Gb) More deletion in mouse

  11. Transposons: Accumulate in same regions

  12. GC-content: human larger tails than mouse

  13. Protein-coding gene count falling (<30,000) Mouse-Human Comparison ~ 99% have homologs (maybe 100%) ~ 96% have homolog in region of conserved synteny ~ 80% have 1:1-ortholog ~22,500 evidence-based gene predictions

  14. Gene family expansions: reproduction, immunity 25 mouse-specific gene family cluster expansions • 14 reproduction • 5 host defense, immunity

  15. Large conserved elements: Coding, Non-coding PPARg Large conserved elements (>100 bp) Exons Non-exons 75% 90%

  16. How much of the genome is under selection? Extremely high conservation: 560,000 anchors Less than half are coding exons (~220,000)

  17. Given neutral substitution rate between mouse-human: Vast majority of truly orthologous sequence can be aligned! Alignable does NOT imply Functional Nucleotide-level alignment: ~40% of genomes WHYT Why so much?

  18. Nucleotide-level alignment: ~40% of genomes WHYT Why so little? Suppose: • Ancestral genome ~2.9 Gb • New transposons are offset by deletion Ancestral genome remaining: • in human = 73% • in mouse = 57% • in both = 73% x 57% = 42%

  19. Neutral substitution rate: ~0.46 per site 0.15 0.31 Human Mouse Substitutions in Ancestral Repeats roughly normal distribution Mouse 2x faster over 75 Myr

  20. Neutral substitution rate: ~0.46 per site Introns Coding exons 5’-UTR 3’-UTR Upstream Downstream CpG Islands Known Regulatory

  21. Proportion of genome under selection: ~5% Neutral sequence: Ancestral repeat Whole genome: Alignable portion Coding Exons only ~1.5% What is the rest? UTR, Regulatory Elements, RNA genes, Structural Elements? Excess Conservation

  22. TNFα enhancer Conserved RefSeq Genscan Human Mouse ACCGCTTCCTCCACATGAGATCATGGTTTTCTCCACCAAGGAAGTTTTCCGAGGGTTGAATGAGAGCTTTTCCCCGCCC ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||| ||||||||||| ACCGCTTCCTCCAGATGAGCTCATGGGTTTCTCCACCAAGGAAGTTTTCCGCTGGTTGAATGA--TTCTTTCCCCGCCC ******* ******** ********** ****** ****** ****** ******** NFat/Ets CRE k3-Nfat Ets Nfat AP1 SP1

  23. Genome evolving at non-uniform rate

  24. Mouse Genome summary • 2.5Gb in size (smaller than human, due to deletion) • More lineage-specific repeats • < 30,000 genes (>99% with homologs in human) • Evolves 2x faster than human • 95% of genome in blocks of conserved synteny • 5% under selection (1.5% coding, the rest is unknown) • Large haplotype blocks of domesticus or musculus ancestry in inbred strains

  25. Implications of mouse sequence • Cloning of Classical mutations • New Mutagenesis programs • Identification of Quantitative Trait Loci (QTLs) • Engineering Knock-outs, Knock-ins • BAC transgenics • Modeling human disease • Understanding gene regulation

  26. Future direction • Finish mouse Genome • Sequence more mammals (dog, chimp, marsupial) • “Genomic accounting” • Identify regulatory elements • Mouse haplotype map

  27. Genomic Alignments for Multiple Species • Sequence more mammals (dog, chimp, marsupial) • “Genomic accounting” • Identify regulatory elements • Mouse haplotype map …. integrated with gene expression analysis

  28. Acknowledgement Washington University John McPherson Bob Waterston Whitehead Institute Kerstin Linblad-Toh Michael C. Zody David Jaffe Claire Wade Mark Daly Jade Vinson Elinor Karlsson EJ Kulbokas Nicole Stange-Thomann Rob Nicol Tim Holzer Toby Bloom Jill Mesirov Chad Nusbaum Bruce Birren Eric Lander Analysis Group David Haussler Jim Kent Arian Smit Chris Pontig Webb Miller Ross Hardison Laura Elnitsky Inna Dubchak Lior Pachter Sean Eddy Michael Brent Roderic Guigo Wayne Frankel Carol Bult Sanger Institute Jim Mullikin Jane Rogers Ensembl Ewan Birney • Mouse Liaison group • University of Oklahoma • Albert Einstein/Harvard • NIH ISC • TIGR • CHORI

  29. Mouse Genome: http://www.ensembl.org/Mus_musculus/ • SNPs: http://aretha.jax.org/pub-cgi/phenome/mpdcgi?rtn=docs/snps

More Related