L proline d glucose and the intracellular cycle of trypanosoma cruzi
Download
1 / 41

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi - PowerPoint PPT Presentation


  • 133 Views
  • Uploaded on

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi. Laboratório de Bioquímica de Parasitas - Depto. de Bioquímica. Instituto de Química - USP. Vertebrate host. Trypomastigote. Intracellular epimastigote. Epimastigote. Amastigote. Metacyclic trypomastigote.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi' - alesia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
L proline d glucose and the intracellular cycle of trypanosoma cruzi

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi

Laboratório de Bioquímica de Parasitas - Depto. de Bioquímica. Instituto de Química - USP


Vertebrate

host

Trypomastigote

Intracellular epimastigote

Epimastigote

Amastigote

Metacyclic trypomastigote

Invertebrate

host


Why to study l proline in t cruzi
Why to study L-Proline in T. cruzi ?

  • Because it is a main carbon and energy source, together with glucose, aspartic acid and glutamic acid.

  • Because it is involved in the differentiation process from the epimastigote to the trypomastigote forms (metacyclogenesis).


Our goals
Our goals

1. To study the relevance of D-Glucose and L-Proline in the intracellular cycle of Trypanosoma cruzi.

2. To characterise the transport of L-Proline and D-Glucose among the different stages of the life cycle of T. cruzi.


Experimental infection model

  • Description:

  • Cells: CHO-K1 (auxotrophic for L-proline)

  • Parasites: Trypomastigotes, CL strain clone 14

  • This model allows:

  • The possibility of modulating the intracellular concentration of proline

  • The possibility of obtaining synchronic cultures


Trypomastigote bursting x [L-proline]

Trypomastigotes x 106 mL-1

Days Post infection



Scheme of experiment

200 mM

L-Proline

200 mM

L-Proline

0 mM

L-Proline

0 mM

L-Proline

200 mM

L-Proline


Trypomastigote bursting x L-Proline in different intracellular stages

Epimastigote

Amastigote

+

+

-

+

Trypomastigotes x 106 mL-1

-

-

+

-

+ 0,2 mM L-Proline

- 0 mM L-Proline

Days Post infection


Intracellular stages x [L-Proline] intracellular stages

Amastigotes

Intracellular epimastigotes

Trypomastigotes

Intracellular forms (106 mL-1)

[L-Proline] (mM)


Transporte de l prolina

L-proline uptake x substrate concentration intracellular stages

Transporte de L-Prolina

System A

Vo (nmols / 20 x 106 cells min)

System B

[L-Proline] (mM)


Proline uptake x intracellular stagesT. cruzi mammalian host stages

Trypomastigotes

Amastigotes

Intracellular epimastigotes

Vm (nmols / 20 x 106 cells min)

[L-Proline] (mM)


Intracellular concentration of free proline in different stages

[Pro] (mM)

±

Intracellular Amastigote

6,61

0,01

±

Intracellular Epimastigote

0,73

0,01

±

Trypomastigote

2,74

0,01

±

Extracellular Epimastigote

6,76

0,04

±

CHO-K1

0,27

0,03


Transporte de l prolina1

Proline uptake in the different environment where stagesT. cruzi lives

Transporte de L-Prolina

Insect vector intestinal content

LIT

10% FCS

Vo (nmols / 20 x 106 cells min)

Human serum

LIT

CHO

Cytoplasm

[L-Proline] (mM)




Conclusions
Conclusions stages

  • We established that in our model proline is a differentiation factor in the intracellular cell cycle of T. cruzi.

  • We propose that proline in the extracellular medium (host-cell cytoplasm) is required as an energy source for the intracellular differentiation from the intracellular epimastigote to the trypomastigote stages.

  • We propose a metabolic switch along the mammalian-host cycle between glucose and proline comsumption, controled by the glucose and proline transporters.


Identification, cloning and functional characterization of amino acid transporters of Trypanosoma cruzi.


Background amino acid transporters of

The metabolism of amino acids is relevant along the parasite life cycle (metacyclogenesis, differentiation inside the mammalian host-cells).

The metabolite transporters of T. cruzi are proteins basically unexplored from a molecular point of view. In fact, the single transporter gene that has been cloned up to now, and which function was biochemically demonstrated is the hexose transporter.

No amino acid transporters were cloned and functionally characterized in trypanosomes up to date.


Goals amino acid transporters of

1. To identify genes coding for amino acid transporters (with particular interest for those coding for Proline, Gluatamate and Aspartate) in trypanosomatids.

2. To characterize the products of these genes from a biochemical, molecular and functional point of view.



PATs identified in putative amino acid transportersT. cruzi




Analysis in sillico of the presence of trans membrane spanners
Analysis putative amino acid transportersin sillico of the presence of trans-membrane spanners

Determinantion of the number of putative trans-membrane helices


Phenogram corresponding to the PATs herein described as well as to other amino acid transporters from other protozoans


Confirmation that the pats correspond to real and expressed sequences
Confirmation that the PATs correspond to real and expressed sequences

PCR from genomic DNA and RT-PCR from total RNA

from infective and non-infective stages.


Conclusions (in brief): sequences

  • Aproximately 1.120.000 sequences corresponding to ESTs and genomic sequences were analysed. Fifteen thousand sequences corresponded to partial ORFs coding for putative amino acid transporters (PATs) .

  • We could identify 60 ORFs corresponding to PATs.

  • All the identified genes match with the AAAP family in the classification of the TC

  • The genes coding for PATs are arranged in tandem repeats in the T. cruzi genome.


Acknowledgements
Acknowledgements: sequences

Dr. Maria Júlia Manso Alves

Dr. Walter Colli

Dra. Silvia Uliana

Dr. Claudio Pereira

Lic. León Bouvier

Dr. Renata Rosito Tonelli

Marcela Martinelli

Camila Galvão Lopes

Support:


Proline as carbon and energy source sequences

Scheme of the intermediary metabolism in trypanosomatids


Modelos de transportadores sequences

Uniport

Simport

Substrato

Ion

Substrato

ATP

Ion

ADP

Antiport

Uniport

Substrato

ATP

Substrato

Ion

ATP

ADP

Ion

ADP





Inhibition of proline uptake by competitors

Aminoácido sequences

competidor

Sistema “A”

Sistema “B”

% inibição

% inibição

-

0

0

L-Prolina

77  3

60 ± 5

D-Prolina

17  6

0

Hidroxiprolina

62 +/+- 9

54 ± 10

Ac. Glutâmico

31 ± 7

0

Ac. Aspártico

24 ± 8

0

Glutamina

0

0

Asparagina

3 ± 7

12 ± 9

Alanina

79 ± 11

48 ± 10

Arginina

15 ± 9

0

Cisteína

63 ± 12

64 ± 10

Glicina

46 ± 6

27 ± 10

Metionina

67 ± 6

13 ± 4

Serina

34 ± 12

12 ± 10

Treonina

0

0

Valina

39 ± 11

56 ± 5

Leucina

51 ± 11

23 ± 12

Isoleucina

32 ± 9

0

Fenilalanina

13 ± 7

0

Histidina

0

0

Lisina

0

0

Triptofano

73 ± 7

0

Inhibition of proline uptake by competitors


Proline uptake x ph
Proline uptake x pH sequences

System A

System B

Vm (nmols / 20 x 106 cells min)



Northern Blot x life cycle stages of inhibitorsT. cruzi

Seqüência da região codificante de transportador de glicose de T. cruzi

1 atgccatcca agaagcagac tgatgtgagt gttggggaca ggcagcccga cgagactctc

61 acattttgct cgttggagaa cctgaaggtt gcacaagtgc aggtggttgg tggaacactg

121 aacggattct caattggctt tgttgccgtg tatgcttatt tctacctgat gtccacggac

181 tgctcgatgt acaagaagga ggtggcgtgc aacagggtat tgaacgcgga gtgttcttgg

241 aacaaaacac gtggagaatg cggctggaac ggctttacct gctttttggg gcacggtaag

301 gataagacgc catgtttgga tgatagcagg tgcaagtggg tgtacagcga cgaagagtgc

361 aagaatccga ctgggtacag ctcgtcctat aacggcatct ttgctggtgc gatgattgtt

421 ggcgcaatga ttgggtcgat ctatgccggg cagtttgccg cgaggtttgg tcacaaggtg

481 tcgttcctga tcgtcggcat cgttggcgtt gtgtcatccg tgatgtacca tgtgtcctcg

541 gcaacgaatgagttttgggt gctgtgcgtt ggtcgtctac tgataggtgt tgtgctcggt

601 cttgtgaacg ttgcatgccc catgtatgtc gaccagaacg cccacccgaa gttccttcac

661 gtggacggtg ttctgtttca ggtgttcacc acgtttggca ttatgtttgc tgcagcgatg

721 gggttggcta ttgggcaaag cgtcaacttt gacaaggaca tcaaaatgga tgcccgcatg

781 cagggctact gtgccttttc tacgctgttg tcggtgctca tggttgcgct tggtatcttc

841 ttgggcgaga gcaagacgaa gtttacgagc ggcaagcacg aggacgatggcactgcgctg

901 gacccgaacg agtacagcta cttgcagatg cttggacctt tggcgatggg actagtgact

961 tccgggacgc tgcaactgac tggcatcaat gccgtgatga attacgcgcc aaagattatg

1021 ggcaacttgg ggatggtgcc tcttgtgggc aacttcgtgg tgatggcgtg gaactttgtg

1081 acaactctcg tctcgattcc acttgcccgg gtcctcacaa tgcgccagct gtttcttggt

1141 gcctcgcttg tggcgtcggt ctcgtgtctg ctcctgtgcg gggtccctgt gtaccccggc

1201 gttgccgata agaacgtgaa gaatggcgtt gcgatcactg gaattgccgt attcatcgcc

1261 gcgtttgaga ttggccttgg accgtgcttc tttgtgcttg cccaggagct gttcccacgc

1321 tctttccgtc cgaggggttc gtccttcgtg ctcttgacga atttcatctt taatgttatc

1381 atcaacgtct gctacccaat cgcgacggag ggcatctctg gcggcccgtc tggcaaccag

1441 gacaagggtc aggcagtcgc gttcatcttt tttggctgca ttggtcttgt ctgcttcgtt

1501 ctgcaggtgt tcttcctgta cccgtgggag gagagcactc ctcagaacca cggagacacc

1561 aacgaagagt ccgcacttcc agaacggcag tcgccgattg aggttgccac ccctggcaac

1621 cgtcaagccg cgtga

Northern Blot: a: epimastigota; b: tripomastigota; c: amastigota

a

b

c

2.7 kpb -

2.1 kpb -



ad