riproduzione ed ereditarieta n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
RIPRODUZIONE ED EREDITARIETA ’ PowerPoint Presentation
Download Presentation
RIPRODUZIONE ED EREDITARIETA ’

Loading in 2 Seconds...

play fullscreen
1 / 77

RIPRODUZIONE ED EREDITARIETA ’ - PowerPoint PPT Presentation


  • 323 Views
  • Uploaded on

RIPRODUZIONE ED EREDITARIETA ’. DNA. STUTTURA DEL DNA DNA : formato da 2 filamenti di nucleotidi NUCLEOTIDE : GRUPPO FOSFORICO + DESOSSIRIBOSIO + BASE AZOTATA COMPLEMENTARIETÀ tra le basi dei 2 filamenti (A-T e C-G) PURINE : A e G (PUR GA) doppio anello. PIRIMIDINE : T e C. DOGMA.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'RIPRODUZIONE ED EREDITARIETA ’' - zia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2
DNA

STUTTURA DEL DNA

  • DNA: formato da 2 filamenti di nucleotidi
  • NUCLEOTIDE: GRUPPO FOSFORICO + DESOSSIRIBOSIO + BASE AZOTATA
  • COMPLEMENTARIETÀ tra le basi dei 2 filamenti (A-T e C-G)
  • PURINE: A e G(PUR GA) doppio anello.
  • PIRIMIDINE: T e C
dogma
DOGMA

mRNA

maturo

TRASCRIZIONE

mRNA

immaturo

DNA

SPLICING

REPLICAZIONE

TRADUZIONE

  • Esempi di eccezioni:
  • Retrovirus
  • miRNA

PROTEINE

traduzione
TRADUZIONE

Conversione dell’informazione fornita dall’mRNA (triplette di nucleotidi = codoni; 64 possibili combinazioni) in aminoacidi trasportati dal tRNA (che presenta un anticodone, cioè una tripletta complementare al codone).

codice genetico
CODICE GENETICO
  • 64 triplette, solo 61 codificanti per 20 aminoacidi.
  • 3 triplette STOP (non codificano).
  • 1 tripletta iniziale (codifica per la Metionina).
esercizio
ESERCIZIO
  • Dato il seguente filamento di DNA, trova la catena aminoacidica corrispondente
  • 3’ TACGATATACCACGGGAGATTACACAGA 5’

AUGCUAUAUGGUGCCCUCUAAUGUGUCU

Met Leu Tyr Gly Ala Leu STOP!!

esercizio1
ESERCIZIO

Quale tra queste serie di triplette non codifica per amminoacidi ma rappresenta un segnale di stop?

  • UAA, UAC, UGA
  • UAG, UGG, UGU
  • CGU, UGG, UGU
  • UAA, UAG, UGA
  • CGU, UAT, UGU

RISPOSTA 4

lessico
LESSICO
  • GENOTIPO: costituzione genetica di un individuo (es. AaBb)FENOTIPO: manifestazione visibile o in qualche modo evidenziabile (es. colore degli occhi; gruppo sanguigno)
  • ALLELI: diverse forme di uno stesso gene
  • LOCUS: specifica localizzazione fisica di un gene su un cromosoma
  • INDIVIDUO OMOZIGOTE: possiede 2 alleli uguali di uno stesso gene, dominanti o recessivi (es. AA; aa)
  • INDIVIDUO ETEROZIGOTE: possiede 2 alleli diversi (es. Aa)
mendel
MENDEL

PRIMA LEGGE DI MENDEL (O DELLA DOMINANZA)

Incrociando due individui omozigoti, ma che differiscono per una coppia allelica, si ottiene una prima generazione F1 costituita da eterozigoti con fenotipo uguale a quello dell’omozigote dominante. Il carattere recessivo non risulta fenotipicamente espresso.

mendel1
MENDEL

SECONDA LEGGE DI MENDEL (O DELLA SEGREGAZIONE)

Incrociando due individui eterozigoti per lo stesso gene si ottiene una progenie F2 costituita per ¼ da omozigoti per l’allele dominante, per ¼ da omozigoti per l’allele recessivo e per ½ da individui eterozigoti. Quindi ¾ presentano fenotipo dominante e ¼ fenotipo recessivo: il rapporto fenotipico è 3:1.

mendel2
MENDEL

TERZA LEGGE DI MENDEL (O DELL’INDIPENDENZA)

Nell’incrocio tra individui che differiscono per 2 caratteri controllati ciascuno da coppie alleliche localizzate su cromosomi diversi (es. AaBb x AaBb), le due coppie di alleli si assortiscono in modo indipendente. Si formano da ogni genitore gameti AB, aB, Ab e ab, ciascuno con frequenza ¼. Si ottiene una progenie con fenotipi in rapporto 9:3:3:1.

dominanza
DOMINANZA
  • DOMINANZA COMPLETA: se gli individui alla F1 presentano il fenotipo uguale a quello del genitore omozigote dominante.
  • DOMINANZA INCOMPLETA: nel caso che presentino un fenotipo intermedio tra quello dei due genitori.
  • CODOMINANZA: se manifestano il fenotipo di entrambi i genitori.
esercizio2
ESERCIZIO

Indicare quale dei seguenti genotipi non è atteso nella progenie di un incrocio AaBb x aabb:

A)AaBb

B)Aabb

C)aaBb

D)aabb

E) AaBB

RISPOSTA E

slide16
A-D

Ereditarietà autosomica dominante

  • Affetti in tutte le generazioni
  • In genere ogni figlio affetto ha almeno un genitore affetto
  • Individui non affetti non trasmettono la malattia
  • In un incrocio di un individuo eteroziogote con un omozigote normale (situazione più frequente), ogni figlio ha la probabilità del 50% di ereditare l’allele anomalo e di essere affetto, e il 50% di ereditare l’allele normale
slide17
A-R

Ereditarietà autosomica recessiva

  • Se il tratto è raro, genitori e parenti che non siano fratelli/sorelle, sono normali
  • Nell’incrocio tra due eterozigoti normali, la frequenza dei genotipi della progenie è 25% omozigoti normali, 25% omozigoti affetti, 50% eterozigoti normali-portatori
  • Tutti i figli di due affetti sono malati
cr sessuali
CR. SESSUALI

I geni delle malattie legate al sesso si trovano sui cromosomi sessuali.

Es: Emofilia/Daltonismo (allele recessivo, presente sul Cromosoma X).

Es:DALTONISMO

  • Donna sana: XDXD
  • Donna portatrice sana: XDXd
  • Donna daltonica: XdXd
  • Uomo sano: XDY
  • Uomo daltonico: XdY
slide19
X-R

Ereditarietà recessiva X-linked

  • Affetti prevalentemente i maschi
  • Un allele recessivo viene trasmesso da un maschio affetto a tutte le figlie femmine (portatrici) che lo trasmettono al 50% dei figli maschi
  • Non si osserva trasmissione padre-figlio maschio
slide20
X-D

Ereditarietà dominante X-linked

  • Maschi affetti trasmettono l’allele mutato a tutte le figlie femmine e a nessun figlio maschio
  • Femmine affette (eterozigoti) trasmettono l’allele mutato al 50% dei figli maschi e al 50% delle figlie femmine
mitocondriale
MITOCONDRIALE

Ereditarietà mitocondriale

  • Solo la cellula uovo materna trasmette il DNA mitocondriale; gli spermatozoi contengono poco citoplasma e il nucleo. Quindi solo le femmine possono trasmettere le malattie mitocondriali alla progenie.
  • Tutti figli di una madre affetta sono affetti
  • Tutti figli di padre affetto sono sani
patologie
PATOLOGIE
  • AUTOSOMICHE DOMINANTI
  • AUTOSOMICHE RECESSIVE

Acondroplasia, Corea di Huntington, Ipercolesterolemia familiare, Poliposi familiare del colon, Sindrome di Marfan, Osteogenesi imperfetta, Sindrome di Waardenburg

Fibrosi cistica, Fenilchetonuria, Anemia falciforme, Talassemia, Sindrome di Tay-Sachs, Deficienza α1 - antitripsina

  • X-LINKED DOMINANTI
  • X-LINKED RECESSIVE

Rachitismo resistente alla vitamina D

Emofilia, Daltonismo, Distrofia muscolare di Duchenne,

Sindrome dell’X fragile

esercizio3
ESERCIZIO
  • Incrocio tra una donna daltonica e un uomo sano

Genotipi: XdXd XDY

esercizio4
ESERCIZIO

I caratteri che dipendono da alleli recessivi del cromosoma X si manifestano:

A) soltanto nelle femmine omozigoti

B) esclusivamente nei maschi

C) con elevata frequenza nei maschi

D) con frequenze irrilevanti nelle femmine

E) nessuna della risposte precedenti è corretta

RISPOSTA C

0 a b ab rh rh
0 A B AB Rh+ Rh-

GRUPPI SANGUIGNI

  • 3 alleli: IA IB I0
  • IA e IB dominano su I0 e codominano tra loro
  • Gruppi fenotipici possibili: 0, A, B, AB
  • ANTIGENE Rh  combinazione di 2 alleli (D; d)
  • DD/Dd  ha l’antigene Rh (Rh+)
  • dd  NON ha l’antigene Rh (Rh-)  produce anticorpi anti-Rh
esercizio5
ESERCIZIO

Nell’albero genealogico gli individui indicati con un simbolo nero sono affetti da una rara malattia ereditaria. L’allele responsabile della trasmissione di questa malattia può essere:

A) allele di DNA mitocondriale

B) associato al cromosoma Y

C) recessivo sul cromosoma X

D) autosomico recessivo

E) autosomico dominante

RISPOSTA D

esercizio6
ESERCIZIO

A) il carattere mutato è legato all’Y

B) si presenta una parte della famiglia reale inglese (alcuni individui erano affetti da emofilia)

C) nelle prossime generazioni le donne non saranno mai malate

D) il padre II-3 deve essere un portatore sano

E) la malattia è autosomica dominante

Nell’albero genealogico:

RISPOSTA B

esercizio7
ESERCIZIO

Una donna daltonica omozigote sposa un uomo che vede normalmente i colori. E’ possibile affermare che:

A) sicuramente avrà figlie femmine senza cecità ai colori

B) avrà 50% figli maschi daltonici e 50% normali

C) avrà figli maschi tutti normali

D) avrà 50% figlie femmine daltoniche e 50% normali

E) avrà figlie femmine tutte daltoniche

RISPOSTA A

esercizio8
ESERCIZIO

Questo albero genealogico è un esempio:

A) di una rarissima malattia non ancora scoperta

B) di ereditarietà mitocondriale

C) di una malattia X-linked dominante

D) di trasmissione di Trisomia 21

E) nessuna delle precedenti

RISPOSTA B

esercizio9
ESERCIZIO

Una donna ha il padre portatore di anemia mediterranea e madre sana. Questa donna sposa un portatore sano, quanta probabilità avrà di avere un figlio malato?

A) 1/2

B) 1/4

C) 1/8

D) 1/9

E) 1/16

RISPOSTA C

alberi1
ALBERI

X-Linked Dominante

alberi2
ALBERI

Autosomica Dominante

alberi3
ALBERI

X-Linked Recessiva

alberi4
ALBERI

Y-Linked

alberi5
ALBERI

Autosomico Recessivo

alberi6
ALBERI

Autosomico Dominante

alberi7
ALBERI

X-recessivo

alberi8
ALBERI

Ereditarietà mitocondriale

dna ricombinante
DNA ricombinante
  • molecola di DNA formata unendo segmenti di DNA provenienti da fonti diverse (es: vettore plasmidico)
  • PLASMIDE: piccola molecola circolare di DNA a doppio filamento presente nelle cellule batteriche
  • codifica per proprietà speciali => vantaggio al battere (resistenza agli antibiotici)
  • trasferiti da una cellula batterica all’altra
  • replicazione insieme alla cellula ospite o autonoma

Procedimento per ottenere vettore plasmidico:

- taglio di un plasmide con nucleasi di restrizione

- inserzione del frammento di DNA da clonare

- unione delle due parti con ligasi

slide43
PCR

Polymerase Chain Reaction: tecnica di biologia molecolare; permette l’amplificazione di una sequenza di DNA mirata (con estremità nucleotidiche note)

Tappe:

  • Denaturazione: per separare il doppio filamento di DNA (96-99°C)
  • Annealing: i primer si legano alle sequenze alle estremità del DNA (40-55°C)
  • Prolungamento: DNA polimerasi sintetizza il secondo filamento (65-72°C)
  • Questa sequenza viene ripetuta => quantità necessaria di frammenti
tessuti1
Tessuti
  • TESSUTO: aggregato di cellule che hanno forma, struttura e funzioni simili, e, per lo più, origine embriologica comune.
  • Ci sono quattro principali tipi di tessuto:
  • Epiteliale
  • Connettivo
  • Muscolare
  • Nervoso
tessuto epiteliale
Tessuto epiteliale

Diviso in: - di rivestimento

- ghiandolare

Alta densità cellulare e cellule vicine

Funzioni: - protezione

- secrezione

  • - mediazione scambi di sostanze

- filtrazione

Non vascolarizzato (connettivo sottostante)

Innervato

Cellule caratteristiche:

  • Cheratinociti
  • Melanociti
  • Cell. di Merkel
  • Cell. di Langherans

Epidermide

tessuto connettivo
Tessuto connettivo
  • Abbondante matrice extracellulare con componente fibrosa
  • Funzioni: - protezione

- sostegno

- trofismo

  • Diviso in:
  • Propriamente detto
  • Denso
  • Lasso
  • In senso lato
  • Osseo
  • Cartilagineo
  • Adiposo
  • Sangue

Never  Neutrofili

Let  Linfociti

Monkey  Monociti

Eat  Eosinofili

Banana  Basofili

tessuto muscolare
Tessuto muscolare
  • Fibrocellule con proprietà contrattile
  • Diviso in:
  • Striato
  • Scheletrico: connesso a scheletro, movimento volontario, placca neuromuscolare
  • Miocardio: sincizio funzionale, strie scalariformi, autoeccitazione
  • Liscio: visceri, utero, sistema nervoso autonomo
tessuto nervoso
Tessuto nervoso

Formato da:

  • Neuroni: - soma

- assone

- dendrite

tessuto nervoso1
Tessuto nervoso
  • cellule di sostegno (glia):
  • Glia centrale:

- oligodendrociti mielina

- astrociti

  • Microglia
  • Glia periferica

- Cell. Di Schwann

mielina

teorie dell evoluzione
Teorie dell’evoluzione

Lamarck (tra ‘700 e ‘800)

2 leggi

1) Legge dell’uso/non uso: un carattere si sviluppa se utilizzato, regredisce se inutilizzato

- MODIFICHE SOLO FAVOREVOLI

- RUOLO DIRETTO AMBIENTE

2) Legge della trasmissione dei caratteri acquisiti durante la vita.

Esempio delle giraffe

MA! Separazione precoce delle linee cellulari somatica e germinale

teorie dell evoluzione1
Teorie dell’evoluzione

Darwin (‘800)

- Gli organismi generano ( in eccesso) figli simili, pur con variabilità in parte ereditabili

- Solo quelli con le varianti che li rendono più adatti, sopravvivono fino a riprodursi.

- MODIFICHE CASUALI

- RUOLO INDIR. AMBIENTE

slide60

Genetica di popolazione

  • Popolazione mendeliana:
  • insiemedi individui della stessa specie (diploide e a riproduzione sessuata) che vivono in una determinata area geografica e che si incrociano liberamente tra loro
  • condividono un pool genico (insieme di geni)
  • la frequenza genica è la frequenza di un particolare allele nella popolazione
  • La variazione frequenze geniche è l’EVOLUZIONE
genetica di popolazione
Genetica di popolazione

Fattori che determinano l’evoluzione:

  • Mutazioni
  • Selezione naturale
  • Migrazioni
  • Deriva genetica

introducono variabilità del pool

riduce variabilità del pool

mutazioni
Mutazioni

Mutazioni:elementi su cui la selezione agisce in modo casuale comparsa di nuovi alleli:

Tipi di mutazioni:

  • neutre
  • favorevoli
  • sfavorevoli

rispetto alle condizioni ambientali della popolazione

selezione naturale
Selezione naturale

Selezione naturale:

  • fattore principale di modifica delle frequenze alleliche
  • mantenimento mutazioni favorevoli o neutre; scomparsa progressiva di quelle sfavorevoli
  • 3 tipi:
  • Selezione stabilizzatrice: riduce fenotipi estremi
  • Selezione direzionale: aumenta nel tempo i fenotipi estremi; avviene in popolazione sottoposta a cambiamenti ambientali
  • Selezione divergente: aumenta i fenotipi estremi, eliminando le forme intermedie. Porta al polimorfismo (coesistenza di forme fenotipicamente distinte in una popolazione)
selezione naturale1
Selezione naturale

Risultato della selezione:comparsa di individui più adatti

es: Biston betularia

migrazione e deriva genetica
Migrazione e deriva genetica

Migrazione

Deriva genetica:

variazione frequenze geniche dovuta a fenomeni casuali:

  • Frequente in piccole popolazioni
  • Effetto a collo di bottiglia(catastrofi naturali, carestie…)
  • Effetto del fondatore
esercizio10
ESERCIZIO

Quale di queste sostanze può non essere di natura proteica?

A) Enzima

B) Colesterolo

C) Ormoni

D) Emoglobina

E) Actina e Miosina

RISPOSTA C

esercizio11
ESERCIZIO

Quale delle seguenti ghiandole non è endocrina?

A) Parotide

B) Tiroide

C) Surrene

D) Ipofisi

E) Ovaio

RISPOSTA A

esercizio12
ESERCIZIO

In quale di questi vasi non circola sangue ossigenato?

A) Arteria Radiale

B) Arteria Polmonare

C) Aorta

D) Arterie coronariche

E) Nessuna delle precedenti

RISPOSTA B

esercizio13
ESERCIZIO

Quale di queste sostanze non è un ormone?

A) Ossitocina

B) ADH

C) TSH

D) Melanina

E) Aldosterone

RISPOSTA D

esercizio14
ESERCIZIO

Quale di queste porzioni dell’apparato digerente non è in grado di assorbire le sostanze?

A) Bocca

B) Stomaco

C) Intestino tenue

D) Intestino crasso

E) Nessuna delle precedenti

RISPOSTA E

ormoni
ORMONI

Definizione

Gli ormoni sono segnali chimici capaci di modificare l’attività di determinate cellule (cellule bersaglio) secreti dalle ghiandole endocrine direttamente nel sangue.

ormoni1
ORMONI

Classificazione

- ormoni peptidici (o proteici)

- ormoni steroidei

- ormoni derivati da amminoacidi

ormoni2
ORMONI

Ipotalamo - **RH

Ipofisi - Neuroipofisi: ADH, Ossitocina

Adenoipofisi: Prolattina, FSH, LH, TSH, ACTH, GH

Epifisi - Melatonina

Tiroide - Tiroxina (T3), Triiodotironina (T4), Calcitonina

Paratiroidi - Paratormone

Pancreas – Insulina, Glucagone, Somatostatina

Surrene – Midollare: Adrenalina, Noradrenalina

Corticale: Mineralcorticoidi, Glucocorticoidi, Ormoni Sessuali

Gonadi – Maschili: Testosterone

Femminili: Estrogeni, Estradiolo, Progesterone

Timo - Timosina

Rene – Renina, Eritropoietina, Vitamina D

Fegato – Somatomedine (IGF-1)

Sistemadigerente - Somatostatina

lessico utile
LESSICO UTILE
  • Epato- = fegato
  • Nefro- = rene
  • Pneumo- = polmone
  • Emo- / Emato- = sangue
  • Angio- = vasi sanguigni
  • Spleno- = milza
  • Cerebello- = cervelletto
  • Cerebro- = cervello
  • Entero- = intestino
  • Mio- = muscolo
  • Cardio- = cuore
  • Condro- = cartilagine
  • -algia = dolore
  • -ite = infiammazione
  • Ectasia = dilatazione
  • Osteo- = ossa
  • Oro- = bocca
  • Isto- = tessuto