slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
BPMV-0 PowerPoint Presentation
Download Presentation
BPMV-0

Loading in 2 Seconds...

play fullscreen
1 / 4

BPMV-0 - PowerPoint PPT Presentation


  • 113 Views
  • Uploaded on

Figure S1 Pflieger et al. Natural light. UV light. UV light. M ock. BPMV-0. BPMV-GFP. Figure S2 Pflieger et al. Black Valentine. SL (21 dpi). Figure S3 Pflieger et al. Black Valentine. JaloEEP558. G19833. BAT93. DOR364. TU. LV. IL (7 dpi ). SL (21 dpi). SL (28 d pi).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'BPMV-0' - zia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Figure S1 Pflieger et al.

Natural light

UV light

UV light

Mock

BPMV-0

BPMV-GFP

slide2

Figure S2 Pflieger et al.

Black Valentine

SL

(21 dpi)

slide3

Figure S3 Pflieger et al.

Black Valentine

JaloEEP558

G19833

BAT93

DOR364

TU

LV

IL

(7 dpi)

SL

(21 dpi)

SL

(28 dpi)

slide4

Figure S4 Pflieger et al.

PvmPDSGCAAGGAATATTATGACCCAAACAAGTCTATGTTAGAGTTGGTTTTTGCACCAGCTGAAG 60

PvaPDSGCAAGGAATATTATGACCCAAACAAGTCTATGTTAGAGTTGGTTTTTGCACCAGCTGAAG 60

GmPDS GCAAGGAATATTATAGCCCAAACCAGTCAATGTTAGAGTTGGTTTTTGCACCAGCCGAAG 60

**************..*******.****:************************** ****

PvmPDSAATGGATTTCACGTAGTGATGAAGATATCATTGAAGCCACAATGTCTGAGCTTGCCAAAC 120

PvaPDSAATGGATTTCACGTAGTGATGAAGATATCATTGAAGCCACAATGTCTGAGCTTGCCAAAC 120

GmPDS AATGGATTTCACGTAGTGACGATGATATTATTCAAGCCACGATGACTGAGCTTGCCAAAC 120

******************* **:***** *** *******.***:***************

PvmPDSTCTTTCCTGATGAAATTTCTGCAGACCAAAGCAAAGCAAAGATTGTCAAGTACCATGTTG 180

PvaPDSTCTTTCCTGATGAAATTTCTGCAGACCAAAGCAAAGCAAAGATTGTCAAGTACCATGTTG 180

GmPDSTCTTTCCTGATGAAATTTCTGCAGACCAAAGCAAAGCTAAGATTCTCAAGTACCATGTTG 180

*************************************:****** ***************

PvmPDSTTAAAACACCAAGGTCGGTTTACAAAACCGTTCCAAATTGTGAACCTTGCCGTCCGGTAC 240

PvaPDSTTAAAACACCAAGGTCGGTTTACAAAACCGTTCCAAATTGTGAACCTTGCCGTCCGCTAC 240

GmPDS TTAAAACACCAAGGTCGGTTTACAAAACTGTTCCAAATTGTGAACCTTGTCGACCCATTC 240

**************************** ******************** **:** *:*

PvmPDSAAAGATCTCCTATTGAAGGTTTCTACTTAGCTGGAGATTACACAAAACAAAAATACTTAG 300

PvaPDSAAAGATCTCCTATTGAAGGTTTCTACTTAGCTGGAGATTACACAAAACAAAAATATTTAG 300

GmPDS AAAGATCTCCTATAGAAGGTTTCTATTTAGCTGGAGATTACACAAAACAAAAATATTTAG 300

*************:*********** ***************************** ****

PvmPDSCTTCAATGGAAGGTGCTGTTCTTTCCG 327

PvaPDSCTTCAATGGAAGGTGCTGTTCTTTCTG 327

GmPDS CTTCAATGGAAGGCGCTGTTCTTTCTG 327

************* *********** *