slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Bacteria are extremely numerous PowerPoint Presentation
Download Presentation
Bacteria are extremely numerous

Loading in 2 Seconds...

play fullscreen
1 / 32

Bacteria are extremely numerous - PowerPoint PPT Presentation


  • 63 Views
  • Uploaded on

Bacteria are extremely numerous. 10 30 vs 10 10 bacteria humans 10 14 vs 10 13 bacterial cells in human cells in a human body a human body.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Bacteria are extremely numerous' - zarifa


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
bacteria are extremely numerous
Bacteria are extremely numerous

1030 vs 1010

bacteria humans

1014 vs 1013

bacterial cells in human cells in

a human body a human body

bacteria can be extremely dangerous
Bacteria can be extremely dangerous
  • In the 19th Century 1 in 7 deaths was caused by a single bacterial lineage (Mycobacterium tuberculosis)
  • TB still causes 1.7 million deaths annually
bacterial genomes are small
Bacterial genomes are small:

4,000,000 bp vs 2 * 3,000,000,000 bp

typical bacteria human

slide9

ACTTGCTTTCGACCCTAGGATTTTACTTCTTT

Point mutation

ACTTGCTTTCGACCCTTGGATTTTACTTCTTT

ACTTGCTTTCGACCCTAGGATTTTACTTCTTT

+

GACCTTAGCATTAT

Homologous

recombination

ACTTGCTTTCGACCTTAGCATTATACTTCTTT

slide12

Branch swapping algorithm

father

daughter

Node that will be transplanted

slide21

?

?

slide25

369

369

369

369

274

274

274

274

621

621

621

621

519

519

519

518

262

262

262

262

275

275

275

275

642

642

642

642

742

742

742

641

641

641

300

300

300

487

487

487

615

615

615

635

635

268

21

21

21

43

43

43

8

8

423

423

423

368

368

368

719

719

719

722

722

722

341

341

341

341

44

44

44

44

748

748

748

752

752

752

712

712

712

302

302

302

345

345

345

345

409

409

409

409

Chicken Ruminant