protein structure databases n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Protein Structure Databases PowerPoint Presentation
Download Presentation
Protein Structure Databases

Loading in 2 Seconds...

play fullscreen
1 / 48

Protein Structure Databases - PowerPoint PPT Presentation


  • 192 Views
  • Uploaded on

Protein Structure Databases. Databases of three dimensional structures of proteins, where structure has been solved using X-ray crystallography or nuclear magnetic resonance (NMR) techniques Protein Databases: PDB (protein data bank) Swiss-Prot PIR ( Protein Information Resource)

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Protein Structure Databases' - yahto


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
protein structure databases
Protein Structure Databases
  • Databases of three dimensional structures of proteins, where structure has been solved using X-ray crystallography or nuclear magnetic resonance (NMR) techniques
  • Protein Databases:
    • PDB (protein data bank)
    • Swiss-Prot
    • PIR (Protein Information Resource)
    • SCOP (Structural Classification of Proteins)
fibrous proteins have a structural role
Fibrous proteins have a structural role
  • Collagen is the most abundant protein in vertebrates. Collagen fibers are a major portion of tendons, bone and skin. Alpha helices of collagen make up a triple helix structure giving it tough and flexible properties.
  • Fibroin fibers make the silk spun by spiders and silk worms stronger weight for weight than steel! The soft and flexible properties come from the beta structure.
  • Keratin is a tough insoluble protein that makes up the quills of echidna, your hair and nails and the rattle of a rattle snake. The structure comes from alpha helices that are cross-linked by disulfide bonds.

Source:http://www.prideofindia.net/images/nails.jpghttp://opbs.okstate.edu/~petracek/2002%20protein%20structure%20function/CH06/Fig%2006-12.GIF

http://my.webmd.com/hw/health_guide_atoz/zm2662.asp?printing=true

the globular proteins
The globular proteins

The globular proteins have a number of biologically important roles. They include:

Cell motility – proteins link together to form filaments which make movement possible.

Organic catalysts in biochemical reactions – enzymes

Regulatory proteins – hormones, transcription factors

Membrane proteins – MHC markers, protein channels, gap junctions

Defense against pathogens – poisons/toxins, antibodies, complement

Transport and storage – hemoglobin and myosin

proteins for cell motility
Proteins for cell motility

Above: Myosin (red) and actin filaments (green) in coordinated muscle contraction.

Right: Actin bound to the mysoin binding site (groove in red part of myosin protein).

Add energy (ATP) and myosin moves, moving actin with it.

Source: http://www.ebsa.org/npbsn41/maf_home.html

http://sun0.mpimf-

slide5

Proteins in the Cell Cytoskeleton

Eukaryote cells have a cytoskeleton made up of straight hollow cylinders called microtubules (bottom left).

They help cells maintain their shape, they act like conveyer belts moving organelles around in the cytoplasm, and they participate in forming spindle fibres in cell division.

Microtubules are composed of filaments of the protein, tubulin (top left) . These filaments are compressed like springs allowing microtubules to ‘stretch and contract’.

13 of these filaments attach side to side, a little like the slats in a barrel, to form a microtubule. This barrel shaped structure gives strength to the microtubule.

Tubulin forms helical filaments

Source:heidelberg.mpg.de/shared/docs/staff/user/0001/24.php3?department=01&LANG=en

http://www.fz-juelich.de/ibi/ibi-1/Cellular_signaling/

http://cpmcnet.columbia.edu/dept/gsas/anatomy/Faculty/Gundersen/main.html

slide6

No catalyst =

Input of 71kJ energy required

Energy

Activation

Energy

With catalase

= Input of 8 kJ energy required

Progress of reaction

Proteins speed up reactions - Enzymes

2

+

2

Catalase speeds up the breakdown of hydrogen peroxide, (H2O2) a toxic by product of metabolic reactions, to the harmless substances, water and oxygen.

The reaction is extremely rapid as the enzyme lowers the energy needed to kick-start the reaction (activation energy)

Substrate

Product

proteins can regulate metabolism hormones
Proteins can regulate metabolism – hormones

When your body detects an increase in the sugar content of blood after a meal, the hormone insulin is released from cells in the pancreas.

Insulin binds to cell membranes and this triggers the cells to absorb glucose for use or for storage as glycogen in the liver.

Proteins span membranes –protein channels

The CFTR membrane protein is an ion channel that regulates the flow of chloride ions.

Not enough of this protein gets inserted into the membranes of people suffering Cystic fibrosis. This causes secretions to become thick as they are not hydrated. The lungs and secretory ducts become blocked as a consequence.

Source: http://www.biology.arizona.edu/biochemistry/tutorials/chemistry/page2.html

http://www.cbp.pitt.edu/bradbury/projects.htm

proteins defend us against pathogens antibodies
Proteins Defend us against pathogens –antibodies

Left: Antibodies like IgG found in humans, recognise and bind to groups of molecules or epitopes found on foreign invaders.

Right: The binding site of an antigen protein (left) interacting with the epitope of a foreign antigen (green)

Source: http://www.biology.arizona.edu/immunology/tutorials/antibody/FR.html

http://tutor.lscf.ucsb.edu/instdev/sears/immunology/info/sears-ab.htm

http://www.spilya.com/research/

http://www.umass.edu/microbio/chime/

making proteins
Making Proteins

How are such a diverse range of proteins possible? The code for making a protein is found in your genes (on your DNA). This genetic code is copied onto a messenger RNA molecule. The mRNA code is read in multiples of 3 (a codon) by ribosomes which join amino acids together to form a polypeptide. This is known as gene expression.

Source: http://genetics.nbii.gov/Basic1.html

gene expression

M

S

F

T

L

K

E

G

G

E

S

G

G

G

M

E

E

E

L

L

L

T

T

T

F

F

F

S

K

M

G

K

F

T

L

S

E

K

S

T

G

A

C

T

A

G

E

G

M

S

K

S

S

G

G

M

G

G

M

K

E

E

K

K

T

M

M

T

T

G

F

G

F

F

G

G

L

E

L

L

E

E

E

E

AUGAGUAAAGGAGAAGAACUUUUCACUGGAUA

E

E

S

G

K

G

M

E

E

L

T

F

The protein folds to form its working shape

Gene Expression

Gene

DNA

Cell machinery copies the code making an mRNA molecule. This moves into the cytoplasm.

Ribosomes read the code and accurately join Amino acids together to make a protein

CELL

The order of bases in DNA is a code for making proteins. The code is read in groups of three

NUCLEUS

Chromosome

S

K

G

E

M

F

E

G

L

T

the building blocks
The building blocks

The amino acids for making new proteins come from the proteins that you eat and digest. Every time you eat a burger (vege or beef), you break the proteins down into single amino acids ready for use in building new proteins. And yes, proteins have the job of digesting proteins, they are known as proteases.

There are only 20 different amino acids but they can be joined together in many different combinations to form the diverse range of proteins that exist on this planet

amino acids

H

S

H

H

H

H

C

C

H

CH3

H

H

C

H

H3C

C

C

C

Amino Acids

An amino acid is a relatively small molecule with characteristic groups of atoms that determine its chemical behaviour.

The structural formula of an amino acid is shown at the end of the animation below. The R group is the only part that differs between the 20 amino acids.

Phenylalanine

Cysteine

Glycine

Alanine

Valine

H

R

O

H

N

H

Acid

Amino

H

H

O

the 20 amino acids
The 20 Amino Acids

The amino acids each have their own shape and charge due to their specific R group.

View the molecular shape of amino acids by clicking on the URL link below:

http://sosnick.uchicago.edu/amino_acids.html

Would the shape of a protein be affected if the wrong amino acid were added to a growing protein chain?

making a polypeptide

R

H

O

R

R

H

O

H

H

O H

H

N

C

C

C

H2N

C

O¯H

O H

O H

O H

C

C

N

C

N

N

H

H

C

C

C

O

R

O

O

R

Peptide Bond

Peptide Bond

Peptide Bond

R

R

H

H

O

O

N

N

C

C

C

C

C

C

H2N

H2N

C

C

O H

O

O

R

R

Making a Polypeptide

Polypeptide

Growth

Polypeptide production = Condensation Reaction

why investigate protein structure
Why Investigate Protein Structure?

Proteins are complex molecules whose structure can be discussed in terms of:

primary structure

secondary structure

tertiary structure

quaternary structure

The structure of proteins is important as the shape of a protein allows it to perform its particular role or function

protein primary structure
Protein Primary Structure

The primary structure is the sequence of amino acids that are linked together. The linear structure is called a polypeptide

http://www.mywiseowl.com/articles/Image:Protein-primary-structure.png

protein secondary structure
Protein Secondary Structure

The secondary structure of proteins consists of:

alpha helices

beta sheets

Random coils – usually form the binding and active sites of proteins

Source: http://www.rothamsted.bbsrc.ac.uk/notebook/courses/guide/prot.htm#I

protein tertiary structure
Protein Tertiary Structure

Involves the way the random coils, alpha helices and beta sheets fold in respect to each other.

This shape is held in place by bonds such as

  • weak Hydrogen bonds between amino acids that lie close to each other,
  • strong ionic bonds between R groups with positive and negative charges, and
  • disulfide bridges (strong covalent S-S bonds)

Amino acids that were distant in the primary structure may now become very close to each other after the folding has taken place

The subunit of a more complex protein has now been formed. It may be globular or fibrous. It now has its functional shape or conformation.

Source: io.uwinnipeg.ca/~simmons/ cm1503/proteins.htm

protein quaternary structure
Protein Quaternary Structure

This is packing of the protein subunits to form the final protein complex. For example, the human hemoglobin molecule is a tetramer made up of two alpha and two beta polypeptide chains (right)

Source: www.ibri.org/Books/ Pun_Evolution/Chapter2/2.6.htm

This is also when the protein associates with non-proteic groups. For example, carbohydrates can be added to form a glycoprotein

Source: www.cem.msu.edu/~parrill/movies/neuram.GIF

protein structure prediction
Protein Structure Prediction
  • Why ?
  • Type of protein structure predictions
    • Sec Str. Pred
    • Homology Modelling
    • Fold Recognition
    • Ab Initio
  • Secondary structure prediction
    • Why
    • History
    • Performance
    • Usefullness
why do we need structure prediction
Why do we need structure prediction?
  • 3D structure give clues to function:
    • active sites, binding sites, conformational changes...
    • structure and function conserved more than sequence
    • 3D structure determination is difficult, slow and expensive
    • Intellectual challenge, Nobel prizes etc...
    • Engineering new proteins
it s not that simple
It's not that simple...
  • Amino acid sequence contains all the information for 3D structure (experiments of Anfinsen, 1970's)
  • But, there are thousands of atoms, rotatable bonds, solvent and other molecules to deal with...
  • Levinthal's paradox
slide28
Summary of the four main approaches to structure prediction. Note that there are overlaps between nearly all categories. Structure prediction
secondary structure predictions
Secondary Structure Predictions

Some highlights in performance

  • 1974 Chou and Fasman 50%
  • 1978 Garnier 62%
  • 1993 PhD 72%
  • 2000 PsiPred 76%
secondary structure prediction 1st generation methods
Secondary structure prediction 1st generation methods
  • Chou and Fassman
    • Assign all residues the appropriate set of parameters.
    • Scan through the peptide and identify helical regions
    • Repeat this procedure to locate all of the helical regions in the sequence.
    • Scan through the peptide and identify sheet regions.
    • Solve conflicts between helical and sheet assignments
    • Identify turns
  • Claims of around 70-80% - actual accuracy about 50-60%
gor iii garnier osguthorpe robson 1990
GOR IIIGarnier, Osguthorpe, Robson, 1990
  • Secondary structure depends on aminoacids propensities
    • As in Chou Fassman
  • Also influences by neighboring residues
    • Helix capping
    • Turns etc
  • How to include distant information.
  • Performance approximately 67%
gor iii garnier osguthorpe robson 19901
GOR III Garnier, Osguthorpe, Robson, 1990

The helix propensity tables thus have 20x17 entries.

Assign the state with the highest propensity

status of predictions in 1990
Status of predictions in 1990
  • Too short secondary structure segments
  • About 65% accuracy
  • Worse for Beta-strands
  • Example:
secondary structure prediction 2nd generation methods
Secondary structure prediction 2nd generation methods
  • sequence-to-structure relationship modelled using more complex statistics, e.g. artificial neural networks (NNs) or hidden Markov models (HMMs)
  • evolutionary information included (profiles)
  • prediction accuracy >70% (PhD, Rost 1993)
phd predictions
PhD-predictions
  • Secondary structure ``prediction'' by homology
  • If sequence of unknown secondary structure has a homologue of known structure, it is more accurate to make an alignment and copy the known secondary structure over to the unknown sequence, than to do ``ab initio'' secondary structure prediction.
3rd generation methods
3rd generation methods
  • enhanced evolutionary sequence information (PSI-BLAST profiles) and larger sequence databases takes Q3 to > 75%
  • PHD and PSIPRED are the best known methods
psipred
PSIPRED
  • Similar to PhD
  • Psiblast to detect more remote homologs
  • only two layers
  • SVM or NN gives similar performance
alignment of protein structure
Alignment of Protein Structure
  • Compare 3D structure of one protein against 3D structure of second protein
  • Compare positions of atoms in three-dimensional structures
  • Look for positions of secondary structural elements (helices and strands) within a protein domain
  • Exam distances between carbon atoms to determine degree structures may be superimposed
  • Side chain information can be incorporated
    • Buried; visible
  • Structural similarity between proteins does not necessarily mean evolutionary relationship
slide43

Structure alignment

T

Find a transformation

to achieve the best

superposition

Simple case – two closely related proteins with the same number of amino acids.

types of structure comparison
Types ofStructure Comparison
  • Sequence-dependent vs. sequence-independent structural alignment
  • Global vs. local structural alignment
  • Pairwise vs. multiple structural alignment
slide45

Sequence-dependent Structure Comparison

2

2

6

6

5

5

7

7

1

1

3

3

4

4

2

2

1

1

4

4

5

5

7

7

3

3

6

6

1234567

ASCRKLE

¦¦¦¦¦¦¦

ASCRKLE

Minimize rmsd

of distances 1-1,...,7-7

sequence dependent structure comparison
Sequence-dependent Structure Comparison
  • Can be solved in O(n) time.
  • Useful in comparing structures of the same protein solved in different methods, under different conformation, through dynamics.
  • Evaluation protein structure prediction.
sequence independent structure comparison

T

Sequence-independent Structure Comparison

Given two configurations of points in the three dimensional space:

find T which produces “largest” superimpositions of corresponding 3-D points.

evaluating structural alignments
Evaluating Structural Alignments
  • Number of amino acid correspondences created.
  • RMSD of corresponding amino acids
  • Percent identity in aligned residues
  • Number of gaps introduced
  • Size of the two proteins
  • Conservation of known active site environments

No universally agreed upon criteria. It depends on what you are using the alignment for.