1 / 57

Middleware for Bioinformaticians: Lessons from the my Grid Project

Middleware for Bioinformaticians: Lessons from the my Grid Project. Carole Goble and the my Grid consortium University of Manchester, UK http://www.mygrid.org.uk. EPSRC funded UK eScience Program Pilot Project.

xandra-riley
Download Presentation

Middleware for Bioinformaticians: Lessons from the my Grid Project

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Middleware for Bioinformaticians: Lessons from the myGrid Project Carole Goble and the myGrid consortium University of Manchester, UK http://www.mygrid.org.uk SIAM Conference on Computational Science and Engineering

  2. EPSRC funded UK eScience Program Pilot Project Particular thanks to the other members of the Taverna project, http://taverna.sf.net SIAM Conference on Computational Science and Engineering

  3. “e-Science is about global collaboration in key areas of science and the next generation of [computing] infrastructure that will enable it.” Sir John Taylor, Director Office of Science and Technology, UK SIAM Conference on Computational Science and Engineering

  4. Science’ = Science + e-Science • Discovery increasingly done in silico on results obtained from experiments using computational analysis & data repositories. • A new era of collection based and simulation based science, in addition to hypothesis driven and experimental science integration mining analysis hypothesis prediction integration analysis mining experiment results SIAM Conference on Computational Science and Engineering

  5. Bioinformatics “The application of computer technology to the management of biological information. Specifically, it is the science of developing computer databases and algorithms to facilitate and expedite biological research, particularly in genomics.” http://www.informatics.jax.org/mgihome/other/glossary.shtml SIAM Conference on Computational Science and Engineering

  6. What does a bioinformatician do all day? SIAM Conference on Computational Science and Engineering

  7. Williams-Beuren Syndrome (WBS) • Contiguous sporadic gene deletion disorder • 1/20,000 live births, caused by unequal crossover (homologous recombination) during meiosis • Haploinsufficiency of the region results in the phenotype • Multisystem phenotype – muscular, nervous, circulatory systems • Characteristic facial features • Unique cognitive profile • Mental retardation (IQ 40-100, mean~60, ‘normal’ mean ~ 100 ) • Outgoing personality, friendly nature, ‘charming’ SIAM Conference on Computational Science and Engineering

  8. Physical Map CTA-315H11 CTB-51J22 GTF2IRD2P Gap FKBP6T POM121 GTF2IP NOLR1 NCF1P PMS2L STAG3 Block B Block A Block C Williams-Beuren Syndrome Microdeletion on Chromosome 7q11.23 C-mid B-mid A-mid A-cen B-cen C-cen B-tel A-tel C-tel WBSCR1/E1f4H WBSCR5/LAB GTF2IRD1 WBSCR21 WBSCR22 WBSCR18 WBSCR14 GTF2IRD2 POM121 NOLR1 BAZ1B BCL7B FKBP6 GTF2I CLDN3 CLDN4 CYLN2 STX1A LIMK1 NCF1 TBL2 RFC2 FZD9 ELN ~1.5 Mb 7q11.23 Patient deletions * * WBS SVAS Chr 7 ~155 Mb SIAM Conference on Computational Science and Engineering

  9. CTA-315H11 CTB-51J22 ‘Gap’ Physical Map WBSCR1/E1f4H WBSCR5/LAB WBSCR21 GTF2IRD1 WBSCR22 WBSCR18 WBSCR14 POM121 GTF2IRD2 NOLR1 BAZ1B BCL7B FKBP6 CLDN3 CLDN4 CYLN2 STX1A GTF2I LIMK1 TBL2 RFC2 FZD9 NCF1 ELN Picture of Lab Scientist Predict Verify Picture of Workflow Candidate genes in the WBS Critical Region SIAM Conference on Computational Science and Engineering

  10. Identification of overlapping sequence CTA-315H11 CTB-51J22 ‘Gap’ Physical Map WBSCR1/E1f4H WBSCR5/LAB WBSCR21 GTF2IRD1 WBSCR22 WBSCR18 WBSCR14 POM121 GTF2IRD2 NOLR1 BAZ1B BCL7B FKBP6 CLDN3 CLDN4 CYLN2 STX1A GTF2I LIMK1 TBL2 RFC2 FZD9 NCF1 ELN Characterisation of nucleotide sequence Characterisation of protein sequence Picture of Lab Scientist Predict Verify Candidate genes in the WBS Critical Region SIAM Conference on Computational Science and Engineering

  11. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt ttaatttgca ttttcctgct 12361 gactaattat gttgagcttg ttaccattta gacaacttca ttagagaagt gtctaatatt 12421 taggtgactt gcctgttttt ttttaattgg gatcttaatt tttttaaatt attgatttgt 12481 aggagctatt tatatattct ggatacaagt tctttatcag atacacagtt tgtgactatt 12541 ttcttataag tctgtggttt ttatattaat gtttttattg atgactgttt tttacaattg 12601 tggttaagta tacatgacat aaaacggatt atcttaacca ttttaaaatg taaaattcga 12661 tggcattaag tacatccaca atattgtgca actatcacca ctatcatact ccaaaagggc 12721 atccaatacc cattaagctg tcactcccca atctcccatt ttcccacccc tgacaatcaa 12781 taacccattt tctgtctcta tggatttgcc tgttctggat attcatatta atagaatcaa Filling a genomic gap in Silico Services published on the web, many without programmatic interfaces SIAM Conference on Computational Science and Engineering

  12. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt ttaatttgca ttttcctgct 12361 gactaattat gttgagcttg ttaccattta gacaacttca ttagagaagt gtctaatatt 12421 taggtgactt gcctgttttt ttttaattgg gatcttaatt tttttaaatt attgatttgt 12481 aggagctatt tatatattct ggatacaagt tctttatcag atacacagtt tgtgactatt 12541 ttcttataag tctgtggttt ttatattaat gtttttattg atgactgttt tttacaattg 12601 tggttaagta tacatgacat aaaacggatt atcttaacca ttttaaaatg taaaattcga 12661 tggcattaag tacatccaca atattgtgca actatcacca ctatcatact ccaaaagggc 12721 atccaatacc cattaagctg tcactcccca atctcccatt ttcccacccc tgacaatcaa 12781 taacccattt tctgtctcta tggatttgcc tgttctggat attcatatta atagaatcaa Filling a genomic gap in Silico Services published on the web, many without programmatic interfaces Public and local databases and data sets Protein-protein interaction algorithms Sequence alignment algorithms Visualisation tools Ontology services Stochastic models for clustering gene expression data Protein folding simulations Gene prediction algorithms Literature searches SIAM Conference on Computational Science and Engineering

  13. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt ttaatttgca ttttcctgct 12361 gactaattat gttgagcttg ttaccattta gacaacttca ttagagaagt gtctaatatt 12421 taggtgactt gcctgttttt ttttaattgg gatcttaatt tttttaaatt attgatttgt 12481 aggagctatt tatatattct ggatacaagt tctttatcag atacacagtt tgtgactatt 12541 ttcttataag tctgtggttt ttatattaat gtttttattg atgactgttt tttacaattg 12601 tggttaagta tacatgacat aaaacggatt atcttaacca ttttaaaatg taaaattcga 12661 tggcattaag tacatccaca atattgtgca actatcacca ctatcatact ccaaaagggc 12721 atccaatacc cattaagctg tcactcccca atctcccatt ttcccacccc tgacaatcaa 12781 taacccattt tctgtctcta tggatttgcc tgttctggat attcatatta atagaatcaa Filling a genomic gap in Silico SIAM Conference on Computational Science and Engineering

  14. Chicken genome Trypanosomiasis in cattle Roslin Institute, UK Steve Kemp, University of Liverpool, Andy Brass University of Manchester, UK Reuseadapting and sharing best practice and know-how across a community Grave’s Disease Simon Pearce and Claire Jennings, Institute of Human Genetics School of Clinical Medical Sciences, University of Newcastle, UK Williams-Beuren Syndrome Hannah Tipney, May Tassabehji, Andy Brass, St Mary’s Hospital, Manchester, UK SIAM Conference on Computational Science and Engineering

  15. No single application Small molecules Proteomics Clinical records Computational steerage of heart simulation codes SIAM Conference on Computational Science and Engineering

  16. Cardiac Vulnerability to Acute Ischemia http://www.bioeng.auckland.ac.nz SIAM Conference on Computational Science and Engineering

  17. Cardiac Vulnerability to Acute Ischemia, Simulation Step Blanca Rodriguez, Oxford Mechanical model • Monitor, Stop, Checkpoint, Discard • Restart with different parameters • Perturb initial conditions: Stage 1 and stage 2 hypoxia Blood perfusion bath model Electrophysio models Simulation protocol“pace at 250 ms…” 1 week to run per simulation Finite Element Bidomain Solver Initial conditions“K+ 5.4 mmol/l… Parameters“Shock strength 50 A.. Result file produced for every 1ms, 7.3MB 200ms simulation Data Analysis SIAM Conference on Computational Science and Engineering

  18. Query nucleotide sequence RepeatMasker BLASTwrapper Pink: Outputs/inputs of a service Purple: Tailor-made services Green: Emboss soaplab services Yellow: Manchester soaplab services GenBank Accession No Promotor Prediction URL inc GB identifier TF binding Prediction Translation/sequence file. Good for records and publications prettyseq Regulation Element Prediction GenBank Entry Amino Acid translation Sort for appropriate Sequences only Identifies PEST seq epestfind Identify regulatory elements in genomic sequence Seqret Identifies FingerPRINTS pscan MW, length, charge, pI, etc Nucleotide seq (Fasta) pepstats 6 ORFs Predicts Coiled-coil regions RepeatMasker pepcoil tblastn Vs nr, est, est_mouse, est_human databases. Blastp Vs nr Coding sequence GenScan BlastWrapper Restriction enzyme map restrict SignalP TargetP PSORTII sixpack Predicts cellular location transeq CpG Island locations and % cpgreport Identifies functional and structural domains/motifs InterPro RepeatMasker Repetitive elements ORFs Hydrophobic regions Pepwindow? Octanol? Blastn Vs nr, est databases. ncbiBlastWrapper SIAM Conference on Computational Science and Engineering

  19. Williams-Beuren Workflows Identification of overlapping sequence Characterisation of protein sequence Characterisation of nucleotide sequence SIAM Conference on Computational Science and Engineering

  20. Experiment life cycle Forming experiments Personalisation Discovering and reusing experiments and resources Executing and monitoring experiments Managing lifecycle, provenance and results of experiments Sharing services & experiments SIAM Conference on Computational Science and Engineering

  21. Forming experiments Personalisation Discovering and reusing experiments and resources Executing and monitoring experiments Managing lifecycle, provenance and results of experiments Sharing services & experiments Middleware for bioinformaticians • Construct, manage and publish in silico experiments, chiefly as workflows, to link up your own and others resources • Data intensive, up stream analysis • Workflow Reuse - foundations for sharing and adapting workflows and resources, and their outcomes, based on semantic descriptions • Whole experiment lifecycle, including provenance SIAM Conference on Computational Science and Engineering

  22. Forming experiments Personalisation Discovering and reusing experiments and resources Executing and monitoring experiments Managing lifecycle, provenance and results of experiments Sharing services & experiments Middleware for bioinformaticians • Open domain services and resources • Open community • Open application • Open model and open data • Open architecture • Service Oriented Architecture • Loosely coupled • Web services based • Assemble your own components • Designed to work together SIAM Conference on Computational Science and Engineering

  23. CScience Outcomes Third-party tools Tavernae-Science workbench LSID Launchpad Haystack Applications Web portals Utopia e-Science process patterns LSID support myGrid information model e-Science mediator e-Science coordination Metadata Management Data Management e-Science events KAVE metadata store Service & workflowdiscovery mIRmyGrid information repository Fetasemantic discovery KAVE provenance capture Core Services Pedro semantic publication Workflow enactment Pedro semantic publication Freefluoworkflow engine GRIMOIRES federated UDDI+ registry Notification service myGrid ontology Web Service (Grid Service) communication fabric External Services Java applications Soaplab AMBITtext extraction service OGSA-DAI DQP service Executable codes with an IDL Gowlab Legacy applications Web Services OGSA-DAI databases Web Sites SIAM Conference on Computational Science and Engineering

  24. Making,wrapping,publishing and discovering services SIAM Conference on Computational Science and Engineering

  25. SOAPLAB Web Service SeqHound Service Any Application Web Service e.g. DDBJ BLAST Workflow Components Freefluo Freefluo Workflow engine to run workflows Scufl Simple Conceptual Unified Flow Language Taverna Writing, running workflows & examining results SOAPLAB Makes applications available SIAM Conference on Computational Science and Engineering

  26. Life Science Identifiers Data and Metadata Management Information Repository and Common Information model for e-Science RDF Knowledge Added Value to Experiment OWL & RDFS Ontologies To annotate and classify entities with a common vocabulary based on a common understanding. SIAM Conference on Computational Science and Engineering

  27. Layering models Operation name, description task method resource application Service name description authororganisation Parameter name, description semantic type format transport type collection type collection format hasInput hasOutput subclass subclass WSDL based operation WSDL based Web service workflow bioMoby service Soaplab service Local Java code SIAM Conference on Computational Science and Engineering

  28. Workflow script Service Registry Failure policy Service Discovery Services Alternates list Service Semantic Annotation Invocation + Data Metadata template Enactor Events External Data Store LSID Event Notification Service LSID + Data LSIDs + Metadata LSID + Data LSID Data Info Repository KAVE External Data Store SIAM Conference on Computational Science and Engineering

  29. WBSCR21 WBSCR27 WBSCR24 WBSCR18 WBSCR22 WBSCR28 STX1A CLDN3 CLDN4 RP11-148M21 RP11-731K22 RP11-622P13 314,004bp extension All nine known genes identified (40/45 exons identified) Biological Outcomes Four workflow cycles totalling The gap was correctly closed and all known features identified A Pseudo gene missed when working by hand discovered WBSCR14 ELN CTA-315H11 CTB-51J22 SIAM Conference on Computational Science and Engineering

  30. CTA-315H11 CTB-51J22 ‘Gap’ Physical Map WBSCR1/E1f4H WBSCR5/LAB WBSCR21 GTF2IRD1 WBSCR22 WBSCR18 WBSCR14 POM121 GTF2IRD2 NOLR1 BAZ1B BCL7B FKBP6 CLDN3 CLDN4 CYLN2 STX1A GTF2I LIMK1 TBL2 RFC2 FZD9 NCF1 ELN Verify Picture of Lab Scientist Predict Verify Candidate genes in the WBS Critical Region Robert Stevens, Hannah J Tipney, Chris Wroe, Tom Oinn, Martin Senger, Phillip Lord, Carole A Goble, Andy Brass and May Tassabehji Exploring Williams-Beuren Syndrome Using myGrid in. Bioinformatics 20:i303-310. Proc of 12th Intelligent Systems in Molecular Biology (ISMB), 31st Jul-4th Aug 2004, Glasgow, UK SIAM Conference on Computational Science and Engineering

  31. Bioinformatics e-Science Outcomes • Elapse time to perform one pipeline from 2 weeks to 2 hours • Data collection improved • Other people have used and want to develop the workflows • Which means describing them so they can be understood • Changed work practices • Analysis all at once • Service interoperability -> results integration SIAM Conference on Computational Science and Engineering

  32. Bioinformaticians Create or wrap services, especially shim services Adapt workflow structure Parameterise services Edit workflow Maintain reuse/repurpose history Search existing work Try out workflow services workflows workflow fragments Register and annotate workflow and new services for reuse Deploy workflow Annotate with - free text - ontology Fragment workflow 3rd party annotation providers Workflow Providers Biologists SIAM Conference on Computational Science and Engineering

  33. Results Integration SIAM Conference on Computational Science and Engineering

  34. ..masked_sequence_of .. nucleotide_sequence project ..part_of organisation >gi|19747251|gb|AC005089.3| Homo sapiens BAC clone CTA-315H11 from 7, complete sequence AAGCTTTTCTGGCACTGTTTCCTTCTTCCTGATAACCAGAGAAGGAAAAGATCTCCATTTTACAGATGAG GAAACAGGCTCAGAGAGGTCAAGGCTCTGGCTCAAGGTCACACAGCCTGGGAACGGCAAAGCTGATATTC AAACCCAAGCATCTTGGCTCCAAAGCCCTGGTTTCTGTTCCCACTACTGTCAGTGACCTTGGCAAGCCCT GTCCTCCTCCGGGCTTCACTCTGCACACCTGTAACCTGGGGTTAAATGGGCTCACCTGGACTGTTGAGCG experiment definition rdf:type ..part_of group urn:lsid:taverna:datathing:13 ..part_of ..author workflow definition ..works_for ..invocation_of ..author person ..BLAST_Report workflow invocation ..similar_sequences_to ..run_for ..run_during service description rdf:type 19747251 AC005089.3 831 Homo sapiens BAC clone CTA-315H11 from 7, complete sequence 15145617 AC073846.6 815 Homo sapiens BAC clone RP11-622P13 from 7, complete sequence 15384807 AL365366.20 46.1 Human DNA sequence from clone RP11-553N16 on chromosome 1, complete sequence 7717376 AL163282.2 44.1 Homo sapiens chromosome 21 segment HS21C082 16304790 AL133523.5 44.1 Human chromosome 14 DNA sequence BAC R-775G15 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence 34367431 BX648272.1 44.1 Homo sapiens mRNA; cDNA DKFZp686G08119 (from clone DKFZp686G08119) 5629923 AC007298.17 44.1 Homo sapiens 12q22 BAC RPCI11-256L6 (Roswell Park Cancer Institute Human BAC Library) complete sequence 34533695 AK126986.1 44.1 Homo sapiens cDNA FLJ45040 fis, clone BRAWH3020486 20377057 AC069363.10 44.1 Homo sapiens chromosome 17, clone RP11-104J23, complete sequence 4191263 AL031674.1 44.1 Human DNA sequence from clone RP4-715N11 on chromosome 20q13.1-13.2 Contains two putative novel genes, ESTs, STSs and GSSs, complete sequence 17977487 AC093690.5 44.1 Homo sapiens BAC clone RP11-731I19 from 2, complete sequence 17048246 AC012568.7 44.1 Homo sapiens chromosome 15, clone RP11-342M21, complete sequence 14485328 AL355339.7 44.1 Human DNA sequence from clone RP11-461K13 on chromosome 10, complete sequence 5757554 AC007074.2 44.1 Homo sapiens PAC clone RP3-368G6 from X, complete sequence 4176355 AC005509.1 44.1 Homo sapiens chromosome 4 clone B200N5 map 4q25, complete sequence 2829108 AF042090.1 44.1 Homo sapiens chromosome 21q22.3 PAC 171F15, complete sequence urn:lsid:taverna:datathing:15 service invocation ..described_by ..created_by ..filtered_version_of A B Keeping track – a Web of science Relationship BLAST report has with other Other classes of information related to BLAST report Jun Zhao, Chris Wroe, Carole Goble, Robert Stevens, Dennis Quan, Mark Greenwood, Using Semantic Web Technologies for Representing e-Science Provenance in Proc 3rd International Semantic Web Conference, Hiroshima, Japan, Nov 2004 SIAM Conference on Computational Science and Engineering

  35. Data Objects Provenance Record Data Objects Data Objects Data Objects Data Objects Data Objects Data Objects Provenance Record Data Objects Provenance Record Building a data model and viewing results Leaky pipes with prior process path dependencies and state SIAM Conference on Computational Science and Engineering

  36. Integrative Biology Projecthttp://www.integrativebiology.ac.uk Scientist designs, initiates and steers simulation from Taverna Workbench Scientists Workflow Workbench Steering of simulations by manipulation of service state Steering Control Process 3 Process 2 Process 1 Enactor Workflow definition sent to enactor myGrid Metadata Stores Process and data provenance captured and stored by metadata services SIAM Conference on Computational Science and Engineering

  37. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt SIAM Conference on Computational Science and Engineering

  38. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt SIAM Conference on Computational Science and Engineering

  39. 12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt SIAM Conference on Computational Science and Engineering

  40. Activation Energy • Important for take up and community building. • And take up leads to much better understanding. • 1 hour to learn how to use the workflow environment • Service scavenge and go • Deal with legacy SIAM Conference on Computational Science and Engineering

  41. Services suck • The workflow are only as good as the services they link together. myGrid ships with access to > 1000 • Bootstrapping services. • Reliability. Stability. Alternates. • Service provider partners. SIAM Conference on Computational Science and Engineering

  42. Sharing takes effort. • Unanticipated reuse by people you don’t know in automated workflows. • The metadata needed pays off but its challenging and costly to obtain.. • Automated, service providers, network effects • Quality control. Misuse. Inappropriate use. • Competitive advantage, Intellectual property. • Workflow design - local or licensed services SIAM Conference on Computational Science and Engineering

  43. Service Name: Blast Operation: execute task: pairwise_local_aligning resource: EMBL application: blastn Parameter: Input: Name: accession semantic type: EMBL Nucleotide sequence id transport data type: string Output: Name: Result semantic type: sequence alignment report transport data type: string A NCBI-BLASTDescription SIAM Conference on Computational Science and Engineering

  44. Task Service class Specific services IBM Life Sciences service setProgram() BLAST SOAPLAB service createJob() setDatabase() BLAST Sequence similarity search BLASTservice run() or setE_value() getResults() blastQuery() Tiered specifications Classes of services Domain “semantic” “Unexecutable” “Potentials” Instances of services Business “operational” “Executable” “Actuals” Wroe C, Goble CA, Greenwood M, Lord P, Miles S, Papay J, Payne T, Moreau L Automating Experiments Using Semantic Data on a Bioinformatics Grid in IEEE Intelligent Systems Jan/Feb 2004 SIAM Conference on Computational Science and Engineering

  45. Disposable SW Lash up Technology driven • Plan to throw away • Separate e-Science research from e-Science development • Support your e-science pioneers Prototype 1 internal User driven pioneers Development track Research track User driven Early adopters Prototype 2 external Migration track SIAM Conference on Computational Science and Engineering

  46. Reusable SW • Design for extensibility and reuse – open systems • Design for the generic but build from the specific • Separate CS research and development tracks • When you are interoperating, standards aren’t boring, they are necessary. • Standards mean you can use everyone else’s stuff. SIAM Conference on Computational Science and Engineering

  47. Science – Computer complexity mismatch • Interoperability and execution complexity • Layers of detail SIAM Conference on Computational Science and Engineering

  48. ‘I want to identify new sequences which overlap with my query sequence and determine if they are useful’ Sequence database entry Fasta format sequence Genbank format sequence Sequence i.e. last known 3000bp Identify new sequences and determine their degree of identity Mask BLAST Simplify and Compare Retrieve Lister Old BLAST result Alignment of full query sequence V full ‘new’ sequence BLAST2 Shim Services SIAM Conference on Computational Science and Engineering

  49. The devil is in the detail Experiment provenance Simple classifications of services Descriptions in biological language Simple workflow Workflows for automagical execution – implicit iteration, generous typing … Descriptions for automatic service execution and fault management Debugging and rerunning provenance logs Expressive ontologies to match up services automatically SIAM Conference on Computational Science and Engineering

  50. Taverna Workbench Scufl language parser Freefluo Workflow Enactor Core Processor Processor Processor Processor Processor Processor Processor Bio MOBY Bio MART Seq Hound Plain Web Service Soap lab Local App Enactor SIAM Conference on Computational Science and Engineering

More Related