slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
E. coli 0157:H7: A New Emerging Disease PowerPoint Presentation
Download Presentation
E. coli 0157:H7: A New Emerging Disease

Loading in 2 Seconds...

play fullscreen
1 / 38

E. coli 0157:H7: A New Emerging Disease - PowerPoint PPT Presentation


  • 182 Views
  • Uploaded on

E. coli 0157:H7: A New Emerging Disease. 1982: First recognized as pathogen 1983: Linked to hemolytic uremic syndrome 1990: Outbreak from drinking water 1991: Outbreak from apple cider 1993: Large outbreak from hamburgers. E. coli 0157:H7: Clinical Manifestations. Condition

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'E. coli 0157:H7: A New Emerging Disease' - wilbur


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
e coli 0157 h7 a new emerging disease
E. coli 0157:H7: A New Emerging Disease
  • 1982: First recognized as pathogen
  • 1983: Linked to hemolytic uremic syndrome
  • 1990: Outbreak from drinking water
  • 1991: Outbreak from apple cider
  • 1993: Large outbreak from hamburgers
e coli 0157 h7 clinical manifestations
E. coli 0157:H7: Clinical Manifestations

Condition

Asymptomatic carriage

Nonbloody diarrhea

Hemorrhagic colitis

Hemolytic-uremic syndrome

Complications of enteric infection

Frequency

Unknown

10%

90%

10% <10 years

<5%

Clin Infect Dis 1995;20:1

slide4
Barium-enema showing “thumbprinting” in colon of child with E. coli O157:H7 hemorrhagic colitis, due to edema and submucosal hemorrhage

N Engl J Med 1995;333:364

colonic biopsy from patient with e coli o157 h7 infection
Colonic biopsy from patient with E. coli O157:H7 infection

Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane

N Engl J Med 1995;333:364

hemolytic uremic syndrome
Hemolytic Uremic Syndrome
  • Days to 2 weeks after gastroenteritis
  • Pallor, bruising, lethargy
  • Anemia (Hgb=5-7 mg/dl), thrombocytopenia
  • Hematuria, acute renal failure
  • Death: 3%-5%
  • E. coli O157:H7 isolated from 96% of patients when culture performed within 6 days of onset
outbreaks of e coli 0157 h7 reported to cdc 1982 1994
Outbreaks of E. coli 0157:H7reported to CDC, 1982-1994

Vehicle

Ground beef

All beef + milk

Water (drinking/swimming)

Person-to-person

Unknown

All outbreaks

No. outbreaks

22

26

3

9

19

69

No. persons

1,137

1,278

276

243

274

2,334

Epidemiol Rev 1996;18:29

e coli 0157 h7 vehicles of infection
E. coli 0157:H7: Vehicles of infection
  • Undercooked hamburgers
  • Bovine manure
  • Contaminated water (e.g., lakes, water slides)
  • Alfalfa sprouts
  • Mayonaise
  • Unpasteurized apple cider
  • Unpasteurized milk
e coli 0157 h7 in food
E. coli 0157:H7 in food
  • Present in any food w/bovine fecal contamination
  • Infectious dose: probably <5 organisms
  • Present in 1%-2% of ground beef, pork, poultry, lamb retail meat samples in Madison, WI
  • Present in about 10% of raw milk samples

Epidemiol Rev 1996;18:29

cases of foodborne illness selected pathogens 1995
Pathogen

Salmonella

Campylobacter

E. coli O157:H7

Clostridium perfringens

Listeria monocytogenes

Staphylococcus aureus

Cases

696,000-3,840,000

1,100,000-7,000,000

8,000-16,000

10,000

928-1,767

1,513,000

Cases of foodborne illness,selected pathogens, 1995

Deaths

870-1,920

110-511

176-433

100

230-485

454

onset of e coli o157 h7 infections and hus dec 1 1992 feb 28 1993 washington state
Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington State

Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases

  • 631 cases reported (501 cult. confirmed)
  • Median age 8
  • 45 cases of HUS, 3 died
  • Median incubation 4 days
  • Undercooked burgers at “chain A”, 58/64 restaurants had at least 1 case
  • Burgers cooked 1 minute/side: routinely associated with internal temp. <68.3 C
  • Molecular epidemiology: single clone

Click for larger picture

JAMA 1994;272:1349

e coli 0157 h7 at the washington county fair new york 1999
E. coli 0157:H7 at the Washington County Fair, New York, 1999
  • 921 persons reported diarrhea
  • E. coli 0157:H7 isolated from 116 persons; 13 coinfected with Campylobacter jejuni
  • 32 infected with C. jejuni alone
  • 65 persons hospitalized, 11 children w/HUS
  • 2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP
  • Source: consumption of water from shallow unchlorinated well

MMWR 1999;48:803

outbreak of e coli o157 h7 among children a ssociated with farm visits montgomery county pa 2000
Outbreak of E. coli O157:H7 Among Children Associated With Farm Visits – Montgomery County, PA, 2000
  • September-November 2000: Montgomery County HD identified 51 persons with diarrhea <10 days of visiting a dairyfarm (farm A)
  • Age range 1-52 years (median: 4 years)
  • Bloody diarrhea (37%), fever (45%), vomiting (45%)
  • 16 patients were hospitalized and eight developed HUS

MMWR 2001;50:293

outbreaks of e coli o157 h7 among children a ssociated with farm visits molecular epidemiology
Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Molecular Epidemiology
  • Isolates from patients indistinguishable by PFGE
  • All 216 cattle on Farm A cultured by rectal swab
    • 28 (13%) positive for outbreak strain
    • Same strain isolated from railing surface

MMWR 2001;50:293

cdc investigator examines a calf at farm a pennsylvania 2000
CDC Investigator Examines aCalf at “Farm A”, Pennsylvania, 2000

MMWR 2001;50:293

slide20
Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Case-Control Study of Risk Factors

Exposure

Contact with cattle

Nailbiting

Food from concession

Handwashing before eating

Odd ratio (95% CI)

10.9 (1.7-70.7)

2.5 (1.1-5.7)

2.5 (1.1-5.7)

0.2 (0.1-0.7)

MMWR 2001;50:293

routine dna fingerprinting by health departments e coli o157 h7 minnesota 1995
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995

N Engl J Med 1997;337:388

patterns on pulsed field gel electrophoresis of e coli o157 h7 in minnesota
Patterns on Pulsed-Field Gel Electrophoresis of E. coli O157:H7 in Minnesota

Lanes 1, 6, 10: E. coli 0157:H7 standard

Lane 5: add. mole. wt. standard

Lanes 2, 4, 7, 8: sporadic cases

Lanes 3, 9: isolates from single cluster

N Engl J Med 1997;337:388

routine dna fingerprinting by health departments e coli o157 h7 minnesota 199523
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995

Click for larger picture

N Engl J Med 1997;337:388

routine dna fingerprinting by health departments e coli o157 h7 minnesota 199 4
Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1994

Click for larger picture

N Engl J Med 1997;337:388

confirmed e coli o157 h7 outbreaks in minnesota 1994 and 1995
Confirmed E. coli O157:H7 outbreaksin Minnesota, 1994 and 1995

Click for larger picture

N Engl J Med 1997;337:388

slide26

Molecular subtyping of E. coli 0157:H7 has revolutionized population-based surveillance for this organism in Minnesota. We now routinely subtype all E. coli 0157:H7 isolates and consider this technique to be an integral part of disease prevention and control in our state.

Minnesota Department of HealthN Engl J Med 1997;377:388

slide27

The Colorado Department of Public Health recently identified an outbreak of E. coli 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 E. coli isolates submitted for routine molecular subtypingsince June 1 were characterized by highly related PFGE patterns. . .

CDCMMWR 1997;46:777.

slide28

PFGE patterns of Salmonella entericaserotype Typhimurium, by Week, Minnesota, June - September 1995

Click for larger picture

N Engl J Med 2001;

344:189

slide29
Coordinated by CDC
  • National network of PH labs that performs PFGE on foodborne bacteria
    • Salmonella serotype Typhimurium
    • Escherichia coli 0157:H7
    • Others planned
  • Permits rapid comparison of PFGE patterns through electronic database at CDC
  • Pennsylvania Department of Health participates

www.cdc.gov/ncidod/dbmd/pulsenet/pulsenet.htm

prevention
Prevention
  • Surveillance for E. coli 0157:H7 and HUS
  • Modernization of food inspection
  • Education of physicians
  • Education of public
limitations of pulsed field gel electrophoresis
Limitations of Pulsed-Field Gel Electrophoresis
  • Substantial intra-/inter-laboratory variation
  • Interpretation of banding patterns subjective
  • Requires additional enzymes to prove “matches”
  • Analyzing across gels difficult
  • PFGE stored as large image files
  • Requires isolation of the organism
  • Slow
  • Ongoing, automated computer analysis difficult
chain termination dna sequencing sanger method
Chain Termination DNASequencing (Sanger Method)

A: New DNA synthesized as

polymerase moves down template

DNA, away from primer

B: Nucleotides added until

dideoxynucleotide incorporated.

C: Labeled primer

D: Labeled deoxynucleotides

Click for larger picture

E: Labeled dideoxynucleotides

multilocus sequence typing mlst
Multilocus Sequence Typing (MLST)
  • Sequencing of multiple housekeeping genes
  • State of the art (human genome project)
  • Objective: no need to compare banding patterns
  • Standardization of methods
  • Fully reproducible
  • Storage, transmission, analysis of ASCII files
  • More appropriate for ongoing, automated computer analysis
  • Do not need to isolate organism in culture
  • Fast
sequence v pfge data
Sequence v. PFGE Data

TTCGAATAAGCTTCCCTGAG

AAGCTTATTCGAAGGGACTC

serratia marcescens outbreak in a nicu
Serratia marcescens outbreak in a NICU

Strain A isolates

  • Mar-Jul 1995, 23 cases
  • Mostly sepsis, 30% died
  • 2 simultaneous outbreaks
  • Most strain “A”, 4 “E”
  • Contamination between NICU (*) and 2 other wards (** and ***)

*

*

**

*

*

*

***

**

*

J Clin Microbiol 1996;34:3138

cluster of serogroup c meningococcal disease associated with a party
Cluster of Serogroup C Meningococcal Disease Associated With a Party
  • Case 1. 18-year-old male with headache, fever, nausea, vomiting on May 19, 1999. On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis.
  • Case 2. 20-year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis.
  • Case 3. 21-year-old male, with headache, neck pain, vomiting, hypotension on May 25, 1999. Blood cultures positive for N. meningitidis
  • Common exposure: Attendance at a (wild!) party on May 14

S Med J, in press

cluster of serogroup c meningococcal disease associated with a party pfge analaysis spe i
Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE Analaysis (SpeI)

Lanes 1, 6, 10: lambda ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group C N. meningitidis control isolates from 1999

1 2 3 4 5 6 7 8 9 10

S Med J, in press

routine molecular epidemiology for enhanced detection and control of foodborne outbreaks summary
Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks: Summary
  • Routine molecular subtyping of key pathogens of public health importance leads to enhanced detection of foodborne outbreaks
  • Routine molecular subtyping should be an integral part of public health surveillance
  • DNA sequence-based methods may eventually replace restriction enzyme-based methods