slide1
Download
Skip this Video
Download Presentation
Central Dogma

Loading in 2 Seconds...

play fullscreen
1 / 17

Central Dogma - PowerPoint PPT Presentation


  • 149 Views
  • Uploaded on

The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Central Dogma' - vita


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1
The following table represents the number of bacteria, algae, viruses, and fungi in a pond at different temperatures. All values represent the number of millions of bacteria, algae, fungi, and viruses in a single liter of water.

2. If the number of bacteria continued to increase at the same rate as the pond continued to warm, what would the measurement be at 30 degrees?

A. 400
B. 640
C. 860
D. 1270

3. Based on the information presented, the number of which of the following substances is not determined by the pond's temperature?

A. Bacteria
B. Fungi
C. Algae
D. Viruses

  • 1. According to the information provided in the table, the number of which of the following substances is constant after a pond reaches a temperature of about 20 degrees?
  • Bacteria
  • B. Fungi
C. Algae
  • D. Virus
central dogma

Central Dogma

How dna becomes you

central dogma1
Central Dogma
  • The idea that DNA is a code that dictates who you are.
transcription
Transcription
  • DNA gets rewritten into RNA

DNA Strand

RNA Strand

slide5
RNA
  • Ribonucleic Acid
  • Single Strand
  • Has Uracil instead of Thymine
  • Nitrogenous Bases: A, C, U, G
transcription1
Transcription
  • -Occurs in Nucleus
  • -RNA Polymerase makes the RNA
transcription practice
Transcription Practice

RNA:

A – U

C – G

  • DNA Strand: A T G G T C C
  • RNA Strand:
transcription practice1
Transcription Practice
  • DNA STRAND:
  • A T G T A T G A T C C G A C G T G
  • RNA STRAND:
translation
Translation
  • “Translates” RNA sequences into amino-acid chains
  • Amino Acid Chains make up proteins

Protein Chain

RNA

translating
Translating
  • Split RNA sequence into sets of three bases (triplet-codons)
  • AUGCGCAAUCAG
  • AUG | CGC | AAU | CAG
translating1
Translating
  • AUG | CGC | AAU | CAG
snork activity
SNORK ACtivity
  • You will make your own SNORK based on the genetic code given
  • Transcribe the sequence into RNA
  • Translate the sequence into an amino-acid chain
  • Find what A.A. sequence codes for what trait
transcribe and translate this into an amino acid chain
Transcribe and translate this into an amino acid chain
  • TACGGCTTTGATCGCGGGCTGATA
  • (First pair to get it right gets a treat!)
reverse translate and transcribe this sequence
Reverse translate and transcribe this sequence
  • MET – PHE – TYR – ALA – HIS – GLU – GLY
  • (First pair to get it right gets a treat!)
ad