vevina
Uploaded by
57 SLIDES
737 VIEWS
570LIKES

DNA

DESCRIPTION

DNA. Mrs. Foles 2010-2011. Jag Mark 9/1/10. How long did you study for your test that you took yesterday? How do you feel about your performance on the test you took yesterday? How will you change the way/length of time that you study for the next test?. Jag Mark 9/2/10.

1 / 57

Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Mrs. Foles 2010-2011

  2. Jag Mark 9/1/10 • How long did you study for your test that you took yesterday? • How do you feel about your performance on the test you took yesterday? • How will you change the way/length of time that you study for the next test?

  3. Jag Mark 9/2/10 • What do plants give off as a waste product during photosynthesis? • What do we give off as a waste product during cellular respiration?

  4. Jag Mark 9/3/10 • Summarize the difference between autotrophs and heterotrophs.

  5. Jag Mark 9/7/10 • What 3 things are in a plant cell that are missing in an animal cell? • What biological process produces new cells to replace older cells? • What is the correct organization of life beginning with cells?

  6. Jag Mark 9/8/10 • What is the structure of DNA? • Draw and label a nucleotide. • Practice • Template Strand: ATCGGTACGTACGTAG • Complement Strand:

  7. Jag Mark 9/9/10 • Describe the 4 different types of organic compounds involved in metabolic activities. • What makes these compounds organic? • Replicate the following DNA strand. • AGTCGTAGCTCGATGCTTA

  8. Jag Mark 9/10/10 • Complete the steps of protein synthesis with the following strand of DNA. (Explain the location and process of each step) • TACGACGTAACT

  9. Jag Mark 9/13/10 • What materials make up a nucleotide? • Draw and label a strand of DNA.

  10. Jag Mark 9/14/10 • Summarize the differences between DNA and RNA.

  11. Jag Mark 9/15/10 • Explain why virus are nonliving. • What are the main components of all viruses?

  12. Jag Mark 9/16/10 • What type of mutation would result in the following mutant strand of DNA? • Normal: ACTCCTGAAGAAAAA • Mutant: ACTCCTGTAGAAAAA • Would this mutation cause a change in the protein being synthesized? • Is this a point-shift or frame-shift mutation?

  13. Jag Mark 9/17/10 • Outline 3 ways to protect yourself from viruses.

  14. Jag Mark 9/20/10 • Summarize the differences between the lytic cycle and the lysogenic cycle.

  15. Jag Mark 9/21/10 • TEST DAY! • Clear desk except for 1 sheet of notebook paper and a pencil.

  16. Carbohydrate: a compound composed of carbon, hydrogen, and oxygen in the proportion of 1:2:1. Lipids: compound that contains a high proportion of carbon and hydrogen with a much smaller amount of oxygen. (Fats, oils, and waxes. Organic Compounds: (Contain Carbon) Of Metabolism!

  17. Proteins: a large molecule made from amino acids. (enzymes: proteins that speed up reactions) Nucleic Acid: large molecule that stores and carries genetic information in the cell. (DNA,RNA) Organic Compounds: (Contain Carbon) Of Metabolism!

  18. Deoxyribonucleic acid Codes for genes and is used in the development and functioning of all living things. Credit for structure is given to Watson and Crick. What is DNA?

  19. What is it made of? • DNA is made up of 4 types of Nucleotides • All nucleotides are identical except for the base • Each nucleotide has 3 materials: • A sugar: deoxyribose • A phosphate • A base

  20. The bases of DNA • Pyrimadine: 1 ring • Thymine (T) • Cytosine (C) • Purine: 2 rings • Adenine (A) • Guanine (G)

  21. Structure and Base Pairing of DNA • Base Pairing • Adenine pairs with Thymine (A=T) • Cytosine pairs with Guanine (C≡G) • Structure • Twisted Ladder/Double Helix • Sides of Ladder • Alternating Phosphate and Sugar • Rungs of Ladder • Pair of nucleotide bases

  22. DNA molecule sides are complementary to each other, therefore DNA can replicate itself if nucleotides are present. When DNA replicates, the bases break apart and the DNA unwinds and unzips. Semi-conservative DNA Replication

  23. Where does replication take place? • In the nucleus! During what phase of the cell cycle? • Practice: • Template: ATTGCAGGCCTTAGTCAC • Replicate:

  24. Practice Problem • AGTTCAGCGGTATTAGCTAGCAACCGT

  25. RNA • DNA can’t leave the nucleus, so it must be “transcribed” into something that can: RNA • Three Types: • mRNA: (messenger) Takes code from DNA in nucleus to ribosome • tRNA: (transfer) Brings in amino acids to build proteins • rRNA: (ribosomal) Makes up ribosomes

  26. RNA is similar to DNA because It is composed of nucleotides BASES: It has C, G, and A. It has a backbone composed on phosphates and sugars RNA is different than DNA because BASE: Instead of Thymine bases there are Uracil bases SUGAR: Instead of dexoyribose there is ribose. RNA is single stranded RNA

  27. An enzyme in the nucleus begins transcription to form mRNA from DNA. mRNA leaves the nucleus and binds to a ribosome. Transcription

  28. Transcription • DNA strand: ATACTGTCAGTATGGCCAT • RNA strand: • Practice problem: • TATTACGACCCGTACTAGAATGGCTCC

  29. Reverse Transcription • DNA strand: • RNA strand: UAGGCUACUGAUCCAAUG

  30. Translation • After mRNA leaves the nucleus it binds to a ribosome in the cytoplasm. • mRNA is read as codons: (three base pairs in a row.) • tRNA brings amino acids to the mRNA that is specific for the codon and forms a peptide chain.

  31. Transcription and Translation

  32. Translation Practice • mRNA: AUG AGC UGG GGG UAU UAG • Amino acid: Met Ser Leu Gly Tyr Stop • Practice • mRNA: AUG UGU AGC CCU AUU UAA • tRNA: • Amino acid:

  33. Central Dogma of Protein Synthesis

  34. Translation • There are 4 base pairs • 20 amino acids • AUG = Start codon • UAA, UAG, UGA = Stop codon • When making proteins, extra amino acids must be brought from cytoplasm.

  35. Made of amino acids (the building blocks of proteins) Several amino acids make a peptide chain Amino acids held together by peptide bonds Proteins

  36. What is a gene? • Instructions for building proteins, traits, and is located on DNA. • Genes are found on chromosomes. • Must have a start codon • Must have a stop codon • Must have a promoter region (TATATTA)

  37. Mutation • Mutations are changes to the base pair sequence of either DNA or RNA. • Causes: copying errors in the DNA during mitosis and by exposure to ultraviolet radiation, xrays, radioactivity, or viruses. • Results: genetic disorders, death, or have no affect. • Most mutations are repaired by enzymes.

  38. Types of Mutation • Insertion: the addition of one or more nucleotide base pairs into a genetic sequence • Ex: Normal: AAACCCGGG Mutated: AAACACCGGG

  39. Deletion: part of a chromosome or a sequence of DNA is missing. Any number of nucleotides can be deleted, from a single base to an entire piece of chromosome. Example Normal: AAACCCGGG Mutated: AAACCGGG Types of Mutation

  40. Substitution: one or more nucleotides are substituted by the same number of different nucleotides.  In most cases, only one nucleotide is changed. Example: Normal: AAACCCGGG Mutated: AAACACGGG Types of Mutation

  41. Types of Mutations • Frame-shift mutation: causes a change all the way down a DNA sequence, making each codon a different sequence. (MORE SERIOUS!) • EX. CAG TTC CTG GAA -> (frameshift)-> CAG TTA CCT GGA • Insertion • Deletion • Point-shift mutation: a single letter is the only thing changed in the DNA sequence • EX. GTA CTG CAA-----> (point mutation) -----> GTA GTG CAA • Substitution

  42. Cell Growth and Repair Cell Cycle the entire life cycle of a cell. Cells divide through a process called Mitosis.

  43. Phases of Mitosis Prophase: The chromatin condenses into chromosomes. Each chromosome has duplicated and now consists of two sister chromatids. The nuclear envelope breaks down into vesicles. Chromatid: name of chromosome once it is duplicated Centromere: Holds chromatid together Metaphase: Chromosomes line up at the equator of the cell.

  44. Phases of Mitosis Anaphase: Sister chromatids separate and move toward the opposite poles. Telephase: The condensed chromatin expands and the nuclear envelope reappears. The cytoplasm divides. Cytokinesis: The cell membrane pinches inward ultimately producing two daughter cells.

  45. During Cytokinesis In plant cells a cell plate forms in between the new cells and will become the cell membrane. A cell wall then forms around the cells.

  46. Cancer • Cancer is a disease in which cells grow and divide uncontrollably, damaging parts of the body around them.

  47. Virus • Virus is a tiny non-living particle that enters and then reproduces inside a living host cell. • Have either DNA or RNA. • May be single stranded or double stranded. • Nonliving because cannot: make food, take in food, use energy, respond to stimuli, make waste or multiply on their own. • Bacteriophage is a virus that infects bacteria.

More Related