vanig
Uploaded by
54 SLIDES
1514 VIEWS
600LIKES

유산균의 동정 및 김치 유산균의 다상 연구

DESCRIPTION

유산균의 동정 및 김치 유산균의 다상 연구. 한국생명공학연구원 생물자원센터 유전자은행 이정숙. Lactic acid bacteria.

1 / 54

Download Presentation

유산균의 동정 및 김치 유산균의 다상 연구

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 유산균의 동정 및 김치 유산균의 다상 연구 한국생명공학연구원 생물자원센터 유전자은행 이정숙

  2. Lactic acid bacteria Gram-positive, non spore-forming, catalase-negative, devoid of cytochromes, of nonaerobic habit but aerotolerant, fastioius, acid-tolerant, cocci or rods, which produce lactic acid as a major sole end product of the fermentation of sugar

  3. Consist of several genera including Aerococcus, Alloiococcus, Carnobacterium, Dolosigranulum, Enterococcus, Globicatella, Lactobacillus, Lactococcus, Lactosphaera, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus, and Weissella (16 genera)

  4. The lactic acid bacteria are of paramount importance in the food industry, both as beneficial organisms and as spoilage organisms. They are used in the production of fermented milk products such as yogurt, sour cream, cheese and butter, and in the production of sausage, pickles, sauerkraut and kimchi. The results of these fermentations are more shelf-stable products with characteristic aromas and flavors. If the growth of lactic acid bacteria is not in some way controlled, they can be a major cause of food spoilage. The souring of milk and the greening of meat are common examples of spoilage resulting from the unchecked activity of these organisms.

  5. Differential characteristics of lactic acid bacteria Character Rods Cocci Carnob. Lactob. Aeroc. Enteroc. Lactoc. Vagoc. Leuconoc. Oenoc. Pedioc. Streptoc. Tetragenoc. Weissella Tetrad formation - - + - - - + - + - CO2 from glucose - ± - - - + - - - + Growth at 10ºC + ± + + + + ± - + + Growth at 45ºC - ± - + - - ± ± - - Growth at 6.5% NaCl ND ± + + - ± ± - + ± Growth at 18% NaCl - - - - - - - - + - Growth at pH 4.4 ND ± - + ± ± + - - ± Growth at pH 9.6 - - + + - - - - + - Lactic acid L D, L, DL L L L D L, DL L L D, DL

  6. Schematic, unrooted phylogenetic tree of the lactic acid bacteria, including some aerobic and facultatively Gram-positives of the low G+C subdivision. Note: evolutionary distances are approximate. (Lactic Acid Bacteria: microbiology and functional aspects/ edited by Seppo Salminen & Atte von Wright. 2nd ed.)

  7. Lactic acid bacteria 분류, 동정의 문제점 • 동일한 선택 배지에서 생육이 가능하며 생리생화학적 특성에 따른 명확한 구분이 어렵다. • 16S rRNA sequence 분석을 통한 분자분류학적 연구 결과로부터 genus간의 혼재되는 양상이 보고되었고, 새로운 genus로의 전이가 진행중이다.

  8. 분류학 연구의 목적 • 기존의 미생물 분류체계 확립 • 분리균의 정확한 동정 • 새로운 유용한 미생물의 발견

  9. Bacterial systematics 의 최근 동향 • Polyphasic taxonomy • 분자계통분류 (Molecular systematics) • 신속 동정 • 재분류 • 새로운 유용한 유전자의 응용

  10. Type of modern bacterial systematics Numerical taxonomy Phenotypic data Molecular systematics Chemotaxonomy Protein analysis Cell wall composition Whole-organism fingerprinting Nucleic acid sequencing RFLP RAPD

  11. Molecular systematic and Chemosystematic analyses of the bacteria cell, and the taxonomic level at which they are generally most useful Cell components Analyses & Methods Taxonomic ranks covered Chromosomal DNA Base composition(mol% G+C) DNA:DNA hybridsation DNA restriction patterns rRNA RFLP(ribotyping) Genus Species Species and subspecies Ribosomal RNA Nucleotide sequence DNA:rRNA hybridsation Species and subspecies Genus and above Protein Amino acid sequence Serological comparisons Electrophoretic patterns Species and genus Cell walls and membranes Peptidoglycan structure Polysaccharides Teichoic acids Fatty acids Polar lipids Mycolic acids Isoprenoid quinones Genus and species Species and subspecies Genus and species Metabolic produces Fatty acids Species and subspecies Complete cell Pyrolysis mass-spectrometry Rapid enzyme tests Genus, species and below Species and subspecies ( modified from Priest and Austin, 1993)

  12. 분자계통분류 • 환경적 요인에 영향을 받지 않음 • 많은 세균의 재분류의 기반 조성 • 종 (species) 을 정의

  13. 세균 분류학에서의 종 (species)이란? • 분류학에서의 정의가 가능한 기본 단위 • DNA-DNA 상동성이 70% 이상인 균주들 (70% 이하일 경우 다른 종) - 1987 국제세균분류위원회 *16S rRNA gene 상동성 97% 이하 DNA-DNA 상동성이 60% 이하  다른 종 (Stackebrandt & Goebel, 1994)

  14. 새로운 유전자의 필요성 • 16S rRNA gene 및 DNA-DNA 상동성의 단점 - 16S rRNA gene : 유연관계가 가까운 균주의 비교에는 적당치 않음 - DNA-DNA 상동성 : 실험상의 어려움 • 다른 유전자가 새로운 정보를 줄 수도 있음

  15. 16S rRNA gene in molecular systematics • 모든 세균에 존재 • 염기서열의 variable region과 conserved region의 분산 존재 • 많은 균주의 염기서열이 결정되어 있음

  16. Chemotaxonomy 분석기기 발달 컴퓨터 발달

  17. 균체지방산 조성 분석 - 세포 지질의 필수 구성성분으로 모든 미생물에 존재 - 10 - 24개 정도의 carbon chain으로 이루어져 있으며 그들의 길이, 이중결합의 위치, 치환기 등에 따라 다양한 형태로 존재 - 최근에는 Microbial Identification System (MIDI; Microbial ID, Inc., Newark, Del., USA) 이라는 Automated Gas Chromatography로 분석

  18. Fatty acids found in bacteria.

  19. HARVESTING Third Quadrant 4 mm Loop Coat Bottom SAPONIFICATION ° Vortex ° 100 C Add 1.0 ml 100 C 5 min Vortex 5-10 sec 25 min cool Reagent # 1 5-10 sec METHYLATION ° 80 1 C , 10 ± ± Add 2.0 ml Vortex 5-10 sec 1 minCool apidly Reagent # 2 EXTRACTION Remove Bottom Add1.25 ml Save Top Phase 10 min Phase Reagent # 3 WASH Remove 2/3 Cap Transfer to Add 3.0 ml 5 min Top Phase GC Vial Reagent # 4

  20. 95개 탄소원 이용성 분석 (BIOLOG system) 95개의 탄소원 이용성을 분석하여 미생물의 동정과 분류에 응용하는 자동화 시스템

  21. Biolog GP microplate water α-cyclodextrin β-cyclodextrin dextirn glycogen inulin mannan tween 40 tween 80 N-acetyl-D-glucosamine N-acetyl-D-mannosamine amygdalin L-arabinose D-arbitol arbutin cellobiose D-fructose L-fucose D-galactose D-galacturonic acid gentiobiose D-gluconic acid α-D-glucose m-inositol α-D-lactose lactulose maltose maltotriose D-mannitol D-manose D-melezitose D-melibiose α-methyl D-galactoside β-methyl D-galactoside 3-methyl glucose α-methyl D-glucoside β-methyl D-glucoside α-methyl D-mannoside palatinose D-psicose D-raffinose L-rhamnose D-ribose salicin sedoheptulosan D-sorbitol stachyose sucrose D-tagalose D-trehalose turanose xylitol D-sylose acetic acid α-hydroxybutyric acid β-hydroxybutyric acid γ-hydroxybutyric acid ρ-hydroxyphenyl acetic acid α-keto glutaric acid α-keto valeric acid lactamide D-lactic acid methylester L-lactic acid D-malic acid L-malic acid methyl pyruvate mono-methyl succinate propionic acid pyruvic acid succinamic acid succinic acid N-acetyl L-glutamic acid alaninamide D-alanine L-alanine L-alanyl-glycine L-asparagine L-glutamic acid glycyl-L-glutamic acid L-pyroglutamic acid L-serine putrescine 2,3-butanediol glycerol adenosine 2'-deoxy adenosine inosine thymidine uridine adenosine-5'-monophosphate tymidine-5'-monophosphate uridine-5'-monophosphate fructose-6-phosphate glucose-1'-phosphate glucose-6-phosphate D-L-α-glycerol phosphate

  22. DNA 염기 조성 분석 • DNA 염기 조성은 • mol % G+C로 표기 • 미생물의 전체 DNA 염기 조성에서 Guanine (G)과 Cytosine (C)이 차지하는 상대적 비율을 나타내며 미생물마다 고유의 조성을 가짐 • 미생물의 속 (genus)과 종 (species)을 기술하는 최소 요건 중 하나로 이용

  23. 세균의 DNA 염기조성의 차이 : 24 - 76 mol % • 분석 방법 : Tm법, Bd법, HPLC법 • G+C mol % 차이 • 5% 이상 : 다른 종 • 10% 이상 : 다른 속

  24. G+C content of taxa taken to represent the main lines of descent of procaryotes

  25. Weissella koreensis sp. nov., isolated from kimchi

  26. Morphological and physiological characteristics irregular short or coccoid rods Gram-positive, catalase-negative and facultative anaerobes grew at 10 and 37 C but not at 42 C (optimum temperature : 25 C) grew at pH 4.0-8.0 (optimum pH : pH 6.0) Chemotaxonomic characteristics Cell wall type : Lys-Ala-Ser Major whole-cell fatty acids : octadecenoic acid (18:1) and hexadecanoic acid (16:0) DNA base compositions : 37 mol% DNA-DNA reassociation analysis Phylogenetic analysis

  27. Characteristic W. kandleri* W. viridescens* W. minor* W. halotolerans* W. confusa* W. paramesenteroides* W. hellenica* W. thailandensis* S-5623T S-5673 Acid produced from: L-Arabinose - - - - - d + + + + Cellobiose - - + - + (d) - - - - Galactose + - - - + + - + - - Maltose - + + + + + + + - - Melibiose - - - - - + - + - - Raffinose - - - - - d - + - - Ribose + - + + + d - + + + Sucrose - d + - + + + + - - Trehalose - d + - - + + + - - Xylose - - - - + d - - + + Hydrolysis esculin - - + - + (+) ND + - - NH3 from arginine + - + + + - - - + + Dextran formation + ND - ND + - - - + + Lactic acid configuration DL DL DL DL DL D D D D D Murein type Lys-Ala-Gly-Ala2 Lys-Ala-Ser Lys-Ser-Ala2 Lys-Ala-Ser Lys-Ala Lys-Ala; Lys-Ser-Ala2 Lys-Ala-Ser Lys-Ala2 Lys-Ala-Ser Lys-Ala-Ser Cell Morphology Irregular rods Small irregular rods Irregular short coccoid rods with rounded to tapered ends Irregular short or coccoid rods Short rods thickened at one end Spherical or lenticular cells Large spherical or lenticular cells Cocci in pairs or in chains Irregular short or coccoid rods Irregular short or coccoid rods G + C content (mol%) 39 41-44 44 45 45-47 37-38 39-40 38-41 37 37 Differential Characteristics of species of the genus Weissella.

  28. Scanning electron micrograph of strain S-5623T. Bar, 1m.

  29. Leuconostoc argentinum DSM 8581T (AF175403) 970 Leuconostoc lactis JCM 6123T (AB023968) 990 Leuconostoc citreum KCTC 3526T (AF111948) 712 Leuconostoc kimchii KCTC 3286T (1F173986) 930 Leuconostoc gelidum DSM 5578T (AF175402) Leuconostoc carnosum NCFB 2776T (X95977) 1000 Leuconostoc mesenteroides subsp. cremoris DSM 20346T (M23034) 1000 Leuconostoc mesenteroides subsp. mesenteroides DSM 20343T (M23035) 934 Leuconostoc pseudomesenteroides NCDO 768T (X95979) Leuconostoc fallax DSM 20189T (S63851) Oenococcus oeni ATCC 23279T (M35820) Weissella paramesenteroides DSM 20288T (M23033) 998 Weissella thailandensis FS61-1T (AB023838) 976 Weissella hellenica NSFB 2973T (X95981) Weissella confusa DSM 20196T (M23036) 1000 Weissella minor DSM 20014T (M23039) 1000 Weissella viridescens DSM 20410T (M23040) Weissella halotolerans DSM 20190T (M23037) Weissella koreensis S5673 (AY035892) 1000 Weissella koreensis S5623T (AY035891) 992 Weissella kandleri DSM 20593T (M23038) Lactobacillus kimchii KCTC 8903PT (AF183558) 828 Lactobacillus .plantarumNCDO 1753T (X52653) 999 928 Lactobacillus brevis ATCC 14869T (M58810) Lactobacillus delbrueckii subsp. delbtueckii ATCC 9649T (M58814) Escherichia coli (V00348) 0.1 Phylogenetic relationships between Weissella koreensis S5623T, S5673, Weissella species and other related bacteria based on 16S rDNA sequences. The branching pattern was generated by the neighbour-joining method. The numbers indicate bootstrap values > 700. The scale bar indicates 0.1 nucleotide substitutions per nucleotide position.

  30. Species % Reassociation with labeled DNA from: S-5673 S-5623T KCTC 3610T KCTC 3504T S-5673 100 103 25 16 S-5623T 90 100 24 16 W. Kandleri KCTC 3610T 21 20 100 14 W. viridescens KCTC 3504T 13 16 9 100 DNA-DNA reassociation values between S-5623T, S-5673, W. kandleri KCTC 3610Tand W. viridescens KCTC 3504 T.

  31. Description of Weissella koreensis sp. nov. Weissella koreensis (ko.re.ensis N. L. adj. koreensis, for Korea, which the new organisms were isolated) Cells are irregular short rod-shaped or coccoid organism. Gram-positive, non-motile, non-spore-forming, catalase-negative and facultative anaerobes. Grows at 10 and 37 C and pH 4.0-8.0 but not at 42C. The optimum temperature and pH for growth were 25C and 6.0, respectively. They did not grow in 8% and 10% NaCl. Arginine is hyrolysed and dextran from sucrose is formed. D(-)-lactic acid and gas from glucose are produced. Acid is produced from L-arabinose, ribose and xylose, but not from cellobiose, galactose, maltose, melibiose, raffinose, sucrose and trehalose. The G+C content of the DNA is 37 mol %. Lys-Ala-Ser in the cell walls. Major cellular fatty acids are C18:1 7cand C16:0. Source: kimchi, Korean traditional fermented vegetable food. The type strain is S-5623T (= KCTC 3621T = KCCM 41516T = JCM 11263T), and reference strain includes S-5673 (= KCTC 3622 = KCCM 41517 = JCM 11264).

  32. Polyphasic Study for Monitoring of the Lactic Acid Bacterial Communities during Kimchi Fermentation

  33. 연구의 목적 • 김치 발효 과정에서의 젖산균의 다양성과 변화 분석 • 김치유래 젖산균의 분류•동정

  34. Culture-dependent approach for diversity and dynamics of the microbial communities during kimchi fermentation

  35. Analysis of FAMEs of isolates from MRS medium A great diversity of fatty acid, at least 37 different ones, was detected in the isolates from kimchi, but 15 of them appeared in less than 5% of the strains tested and will not be considered in detail further. Four fatty acids such as C14:0, C16:0, C18:1 ω9c, and summed feature 7 appeared in all strains tested. Four fatty acids such as C16:1 ω7c,C18:0, C19:0 CYCLO ω8c, and Summed feature 9 appeared in more than 70% of the strains tested. Cluster analysis revealed 7 major FANE clusters and 1 single cluster that are presented in an abridged dendrogram. The clusters defined at Euclidian distance of 17.5. Analysis of FAMEs of isolates from PES medium The fatty acid compositions of the 79 presumptive Leuconostoc strains were determined. Three of the 28 different fatty acid types were excluded from the final data analysis since these were detected in less than 5% of the strains All 79 strains contained C14:0, C16:0, C18:0, C18:1 ω9c, summed feature 4, and summed feature 7. Seven fatty acids such as C15:0, C16:1 ω5c, C17:1 ω8c, C19:1 iso, C19:0 CYCLO ω8c, summed feature 6, and summed feature 9 appeared in more than 70% of the strains tested. All 79 strains were identified to known clusters, i.e. B, C and D, at a Euclidian distance of 17.5.

  36. Euclidian distance 30.00 20.00 10.00 0.00 Cluster Number of strains Identity A 6 Leu. mesenteroides subsp. dextranicum B 61 Leuconostoc sp. Leu. citreum Leu. pseudomesenteroides C 79 Lab. delbruekii subsp. delbruekii Lab. casei G 8 Lab. plantarum Lab. parabuchneri F 28 Lab. plantarum Lab. animalis Lab. brevis E F 21 H 1 Leuconostoc sp. Leu. mesenteroides subsp. mesenteroides Leu. mesenteroides subsp. cremoris Leu. carnosum Leu. lactis D 24 Dendrogram showing the relationship between the isolates from MRS medium based on their cellular fatty acid profiles.

  37. Analysis of carbon-source utilization patterns of isolates from MRS medium The test strains were recovered in five major, one minor and twelve single clusters defined at the SSM level of 80%. Analysis of carbon-source utilization patterns of isolates from PES medium All 75 strains were identified to known clusters, i.e. M, N, O and P, at the SSM level of 80%.

  38. Number of strains Percentage Similarity Cluster Identity 50 60 70 80 90 100 R 2 Lactobacillussp. M 54 Leu. ameliobiosum N 59 Leu. m. mesenteroides Lab. plantarum Lab. d. delbrueckii Lab. casei Q 20 S5386 Leuconostoc sp. Leu. pseudomesenteroides Leu. lactis Lab. animalis Lab. brevis Lab. parabuchneri O 25 S3 S136 S5486 S185 S176 Leuconostoc sp. Leuconostoc sp. Lactobacillus sp. 11 P KCTC3526 Leu. citreum S123-2 S178 S5299 S199 Leuconostoc sp. S5393 Abridged dendrogram showing the relationships between the isolates from MRS medium defined in the SSM, UPGMA analysis.

  39. 균체지방산 조성 분석이나 탄소원 이용성 분석에 따라 lactic acid bacteria의 그룹화가 이루어지며, 이에 따른 데이터베이스를 구축할 수 있다. 그리고 분리균주를 각각의 데이터베이스와 비교하여 분류하는 것도 가능하다. • 그러나, 두가지 방법에 따른 데이터베이스 상호간의 일치점을 명확히 규명하기는 어렵다. • Culture-dependent methods의 한계점을 극복할만한 새로운 측면의 연구 방법 모색이 필요하다.

  40. Molecular monitoring for diversity and dynamics of the microbial communities during kimchi fermentation

  41. Denaturing Gradient Gel Electrophoresis (DGGE) DGGE is based on the principle that increasing denaturant concentration will melt double-stranded DNA in distinct domains. When the melting temperature (Tm) of the lowest domain is reached, the DNA will partially melt, creating branched molecules with reduced mobility in a polyacrylamide gel. The denaturing environment is created by a uniform run temperature between 50 and 65C and a linear denaturant gradient formed with urea and formamide. The gradient may be formed perpendicular or parallel to the direction of electrophoresis. DGGE is one of the most sensitive mutation detection methods, providing efficiency up to 99%. Based on this principle, DGGE is used to be a suitable tool for the study of microbial diversity.

  42. Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction. This shows a single melting domain. At low denaturant concentration (left) the DNA fragment remains double stranded, but as the concentration increases (moving right) the DNA fragment begins to melt, creating a branched molecule. At very high concentrations, the DNA fragment can completely melt, creating two single strands. (Upper) A, Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction. B, Parallel denaturing gradient gel in which gradient is parallel to the electrophoresis direction. lane 1, mutant fragment; lane 2, wild-type fragment; lane 3, mutant and wild-type fragments. (lower)

  43. 방법 Isolation of DNA • PCR-DGGE analysis • Primer set (gc338f/518r) • PCR condition (“touchdown” PCR) • 8% (wt/vol) polyacrylamide gels in 1X TAE • denaturing gradient ranging from 10% to 50% urea-formamide denaturing gradient (with 100% defined as 7 M urea and 40% [vol/vol] formamide) • gel electrophoresis : 16 h at 60 V • Staining : SYBR Green I (Sigma Co., St. Louis, MS) for 30 min Sequencing of DGGE fragments Analysis of the sequence data

  44. 16S rRNA-targeted PCR primers used in this study. Primer 338f 518r Sequence (5’-3’) ACT CCT ACG GGA GGC AGC AG ATT ACC GCG GCT GCT GG Position 357-338 534-518 Reference Lane, D. J. (1991) Muyzer, A. E. et al. (1993) A GC clamp was attached to the 5’ end of primer 338f to obtain primer gc338f (GC clamp, 5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGCACGGGGGG). Muyzer, A. E. et al. (1993)

More Related