Download
dna and protein synthesis notes n.
Skip this Video
Loading SlideShow in 5 Seconds..
DNA and Protein Synthesis Notes PowerPoint Presentation
Download Presentation
DNA and Protein Synthesis Notes

DNA and Protein Synthesis Notes

228 Views Download Presentation
Download Presentation

DNA and Protein Synthesis Notes

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. DNA and Protein Synthesis Notes November 17, 2011

  2. A. Function of Nucleic Acids • Control the processes of heredity by which cells and organisms reproduce proteins.

  3. B. Types of Nucleic Acids • DNA: Deoxyribonucleic Acid • RNA: Ribonucleic Acid

  4. C. Structure of Nucleic Acids • Made up of a chain of Nucleotides that contain • Phosphate backbone • Sugar • Nitrogen base • Guanine • Cytosine • Adenine • Thymine (Found only in DNA) • Uracil (Found only in RNA)

  5. DNA SUGAR Phosphate

  6. D. DNA vs. RNA • Sugar is Ribose • Has nitrogen base Uracil instead of Thymine • Also contains the other 3 bases • Only single stranded

  7. II. Protein Synthesis • It’s a process • DNA -> RNA -> Amino Acids (Protein)

  8. Three processes in this unit… • Replication (DNA DNA) *REPLICATION IS NOT ON THE TEST BUT PAY ATTENTION ANYWAY…FOR KNOWLEDGE SAKE…COMES UP AGAIN IN MITOSIS…YOU’LL LEARN DETAILS IN AP BIO 2. Transcription (DNA mRNA) 3. Translation (RNA Protein)

  9. A. DNA Replication • Occurs in the nucleus prior to any cell division • Enzyme is used to “unzip” or “unwind” the DNA • Forms a bubble at the origin site

  10. DNA replication- replication bubbles

  11. DNA replication- leading/lagging strands

  12. DNA replication

  13. DNA Replication (cont.) • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA • Nitrogenous bases pair up • A – T • C - G • As a result, you create two identical strands of DNA

  14. Let’s Practice • Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

  15. B. Transcription • DNA strand unzips • The bonds between the nitrogen bases are broken • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA • A single strand of mRNA (messenger RNA) is made • Pair up the bases • A  U • T  A • C  G • G  C • mRNA then travels from nucleus to cytoplasm

  16. Transcription

  17. Where in the cell does transcription take place? • Cytoplasm • Mitochondria • Nucleus • Golgi Body • Vacuole

  18. Any given segment of DNA has directions that make unique what? • Glucose • Proteins • Lipids • Blood cells

  19. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence? • T G A C C A G G T T • A C T G G T C C A A • T G U C C U G G T T • U G A C C A G G U U

  20. a. Why is mRNA called messenger RNA? • Because it carries the directions to make a protein to the ribosome like a message

  21. 4. Types of RNA • mRNA- messenger • Brings message from nucleus to ribosomes in cytoplasm • rRNA- ribosomal • Make up a ribosome • tRNA- transfer • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

  22. The difference between RNA and DNA is what? • The phosphates • The sugars • The nitrogen bases • The way the monomer units bond

  23. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? • Mitochondria • Ribosome • Golgi Body • Lysosome • Nucleus

  24. C. Translation • mRNA meets up with a ribosome…why?? • Function of ribosome is to be site for protein synthesis • tRNA molecules bring amino acids to ribosomes • An mRNA codon will pair with a tRNA anticodon • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid • Anticodon: 3 Nitrogen base sequence in tRNA

  25. Translation (cont.) • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

  26. How do you know what amino acids make up a particular protein? • We use an mRNA codon chart

  27. Where in the cell does transcription, the first part of protein synthesis, take place? • Mitochondria • Nucleus • Ribosomes • Cytoplasm

  28. DNA has the directions to make what? • Glucose • Nucleotides • Proteins • Monosaccharides

  29. After a strand of mRNA is made where does it go? • Ribosome • Mitochondria • Lysosome • Vacuole

  30. Where in the cell does translation, the second part of protein synthesis, take place? • Mitochondria • Nucleus • Golgi body • Cytoplasm

  31. Molecules called tRNA’s are floating around the cytoplasm carrying what? • mRNA’s • Glucose • DNA • Nucleotides • Amino Acids

  32. An mRNA codon is made up of how many nitrogen bases? • 1 • 3 • 6 • 24

  33. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? • Phenylalanine • Glutamine • Asparagine • Lysine • Tyrosine

  34. What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C • Threonine – phenylalanine – glutamate – tyrosine • Phenylalanine – leucine – methionine – valine • Tyrosine – glutamate – phenylalanine – threonine • Lysine – cysteine – arginine – histidine

  35. What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G • Isoleucine – alanine – histidine – alanine • Isoleucine – histidine – alanine – isoleucine • Phenylalanine – leucine – valine – arginine • Isoleucine – leucine – threonine – lysine