dna and protein synthesis notes l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DNA and Protein Synthesis Notes PowerPoint Presentation
Download Presentation
DNA and Protein Synthesis Notes

Loading in 2 Seconds...

play fullscreen
1 / 36

DNA and Protein Synthesis Notes - PowerPoint PPT Presentation


  • 187 Views
  • Uploaded on

DNA and Protein Synthesis Notes. November 17, 2011. A. Function of Nucleic Acids. Control the processes of heredity by which cells and organisms reproduce proteins. B. Types of Nucleic Acids . DNA: Deoxyribonucleic Acid RNA: Ribonucleic Acid. C. Structure of Nucleic Acids.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA and Protein Synthesis Notes' - ursula


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
a function of nucleic acids
A. Function of Nucleic Acids
  • Control the processes of heredity by which cells and organisms reproduce proteins.
b types of nucleic acids
B. Types of Nucleic Acids
  • DNA: Deoxyribonucleic Acid
  • RNA: Ribonucleic Acid
c structure of nucleic acids
C. Structure of Nucleic Acids
  • Made up of a chain of Nucleotides that contain
    • Phosphate backbone
    • Sugar
    • Nitrogen base
      • Guanine
      • Cytosine
      • Adenine
      • Thymine (Found only in DNA)
      • Uracil (Found only in RNA)
slide5
DNA

SUGAR

Phosphate

d dna vs rna
D. DNA vs. RNA
  • Sugar is Ribose
  • Has nitrogen base Uracil instead of Thymine
    • Also contains the other 3 bases
  • Only single stranded
ii protein synthesis
II. Protein Synthesis
  • It’s a process
    • DNA -> RNA -> Amino Acids (Protein)
three processes in this unit
Three processes in this unit…
  • Replication (DNA DNA)

*REPLICATION IS NOT ON THE TEST BUT PAY ATTENTION ANYWAY…FOR KNOWLEDGE SAKE…COMES UP AGAIN IN MITOSIS…YOU’LL LEARN DETAILS IN AP BIO

2. Transcription (DNA mRNA)

3. Translation (RNA Protein)

a dna replication
A. DNA Replication
  • Occurs in the nucleus prior to any cell division
  • Enzyme is used to “unzip” or “unwind” the DNA
    • Forms a bubble at the origin site
dna replication cont
DNA Replication (cont.)
  • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA
    • Nitrogenous bases pair up
      • A – T
      • C - G
  • As a result, you create two identical strands of DNA
let s practice
Let’s Practice
  • Replicate the following strand of DNA using the correct nitrogenous bases:

ATCGGCTATTAGGCATATCCGACGGTC

TAGCCGATAATCCGTATAGGCTGCCAG

b transcription
B. Transcription
  • DNA strand unzips
    • The bonds between the nitrogen bases are broken
    • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA
  • A single strand of mRNA (messenger RNA) is made
    • Pair up the bases
      • A  U
      • T  A
      • C  G
      • G  C
  • mRNA then travels from nucleus to cytoplasm
where in the cell does transcription take place
Where in the cell does transcription take place?
  • Cytoplasm
  • Mitochondria
  • Nucleus
  • Golgi Body
  • Vacuole
any given segment of dna has directions that make unique what
Any given segment of DNA has directions that make unique what?
  • Glucose
  • Proteins
  • Lipids
  • Blood cells
slide19
If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence?
  • T G A C C A G G T T
  • A C T G G T C C A A
  • T G U C C U G G T T
  • U G A C C A G G U U
a why is mrna called messenger rna
a. Why is mRNA called messenger RNA?
  • Because it carries the directions to make a protein to the ribosome like a message
4 types of rna
4. Types of RNA
  • mRNA- messenger
    • Brings message from nucleus to ribosomes in cytoplasm
  • rRNA- ribosomal
    • Make up a ribosome
  • tRNA- transfer
    • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain
the difference between rna and dna is what
The difference between RNA and DNA is what?
  • The phosphates
  • The sugars
  • The nitrogen bases
  • The way the monomer units bond
mrna is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle
mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle?
  • Mitochondria
  • Ribosome
  • Golgi Body
  • Lysosome
  • Nucleus
c translation
C. Translation
  • mRNA meets up with a ribosome…why??
    • Function of ribosome is to be site for protein synthesis
  • tRNA molecules bring amino acids to ribosomes
  • An mRNA codon will pair with a tRNA anticodon
    • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid
    • Anticodon: 3 Nitrogen base sequence in tRNA
translation cont
Translation (cont.)
  • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.
how do you know what amino acids make up a particular protein
How do you know what amino acids make up a particular protein?
  • We use an mRNA codon chart
where in the cell does transcription the first part of protein synthesis take place
Where in the cell does transcription, the first part of protein synthesis, take place?
  • Mitochondria
  • Nucleus
  • Ribosomes
  • Cytoplasm
dna has the directions to make what
DNA has the directions to make what?
  • Glucose
  • Nucleotides
  • Proteins
  • Monosaccharides
after a strand of mrna is made where does it go
After a strand of mRNA is made where does it go?
  • Ribosome
  • Mitochondria
  • Lysosome
  • Vacuole
where in the cell does translation the second part of protein synthesis take place
Where in the cell does translation, the second part of protein synthesis, take place?
  • Mitochondria
  • Nucleus
  • Golgi body
  • Cytoplasm
molecules called trna s are floating around the cytoplasm carrying what
Molecules called tRNA’s are floating around the cytoplasm carrying what?
  • mRNA’s
  • Glucose
  • DNA
  • Nucleotides
  • Amino Acids
using your mrna codon chart what amino acid would a ribosome call for if the codon was a a c
Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ?
  • Phenylalanine
  • Glutamine
  • Asparagine
  • Lysine
  • Tyrosine
what protein would be synthesized from the following mrna strand a c u u u c g a a u a c
What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C
  • Threonine – phenylalanine – glutamate – tyrosine
  • Phenylalanine – leucine – methionine – valine
  • Tyrosine – glutamate – phenylalanine – threonine
  • Lysine – cysteine – arginine – histidine
what protein would be synthesized from the following dna segment t a a g t a c g c t a g
What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G
  • Isoleucine – alanine – histidine – alanine
  • Isoleucine – histidine – alanine – isoleucine
  • Phenylalanine – leucine – valine – arginine
  • Isoleucine – leucine – threonine – lysine