slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003) PowerPoint Presentation
Download Presentation
Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003)

Loading in 2 Seconds...

play fullscreen
1 / 34

Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003) - PowerPoint PPT Presentation


  • 88 Views
  • Uploaded on

Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003). Struggle, Limited Success, Struggle…. Devices?. System??. Design & Fabrication. Application. Struggle, Success, Predictable Success. Applications. Systems. Parts & Fabrication. Design.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003)' - ulani


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
struggle limited success struggle
Struggle, Limited Success, Struggle…

Devices?

System??

Design &

Fabrication

Application

struggle success predictable success
Struggle, Success, Predictable Success

Applications

Systems

Parts &

Fabrication

Design

enabling biological engineering
Enabling Biological Engineering
  • Decoupling
    • Rules insulating design process from details of fabrication
    • Enable parts, device, and system designers to work together
    • VLSI electronics, 1970s
  • Standardization
    • Predictable performance
    • Off-the-shelf
    • ME, 1800s
  • Abstraction
    • Insulate relevant characteristics from overwhelming detail
    • Simple artifacts that can be used in combination
    • From Physics to EE, 1800s
abstraction
Abstraction

Systems

Devices

Parts

parts
Parts

Zif268, Paveltich & Pabo c. 1991

devices

CI

LacI

Devices

CI

LacI

RBS

l cI-857

OLac

T

devices1
Devices

LacI  CI inverter

LacI

CI

systems
Systems

Inverter.1

Inverter.2

Inverter.3

interfaces

Zif268, Paveltich & Pabo c. 1991

Interfaces

Systems

Inv.1

Inv.2

Inv.3

LacI 

CI

inverter

LacI

CI

Devices

Parts

parts device interface

Zif268, Paveltich & Pabo c. 1991

Parts/Device Interface

LacI 

CI

inverter

LacI

CI

Devices

Parts

stories
Stories

“In 1910, I was in Mexico, in the state of Yucatan, when an invasion of locusts occured; the Indians reported to me that in a certain place the ground was strewn with the corpses of these insects. I went there and collected sick locusts, easily picked out since their principal symptom was an abundant blackish diarrhoea. This malady had not as yet been described, so I studied it. It was a septicaemia with intestinal symptoms, It was caused by bacteria, the locust coccobacilli, which were present almost in the pure state in the diarrhoeal liquid. I could start epidemics in columns of healthy insects by dusting cultures of the coccobacillus on plants in front of the advancing columns: the insects infected themselves as they devoured the soiled plants…

In the course of these researches, at various times I noticed an anomaly, shown by some cultures of the coccocacillus which intrigued me greatly, although in fact the observation was ordinary enough, so banal indeed that many bacteriologists had certainly made it before on a variety of cultures. The anomaly consisted of clear spots, quite circular, two or three millimeters in diameter, speckling the cultures grown on agar.”

From The Bacteriophage by Dr. Felix d'Herelle, Science News 14: 44-59 (1949). (Translation by J. L. Crammer)

parts device interface1

A  B

inverter

A

B

Zif268, Paveltich & Pabo c. 1991

Parts/Device Interface

LacI 

CI

inverter

LacI

CI

Devices

X

X

Parts

device system interface

A  B

inverter

C  D

inverter

E  F

inverter

A

C

E

B

D

F

Device/System Interface

Inv.1

Inv.2

Inv.3

Systems

Devices

device system interface1

E  F

inverter

A  B

inverter

C  D

inverter

A

E

C

D

B

F

Device/System Interface

X

A  B

E  F

C  D

X

X

Systems

Devices

device system interface2

C  D

inverter

E  F

inverter

A  B

inverter

E

C

A

F

D

B

Device/System Interface

A  D

A  B

E  F

C  D

X

X

Systems

X

Devices

device system interface3

cI

LacI

cI

PoPSin

RBS

l cI-857

OLac

T

RBS

l cI-857

Ol

T

PoPSout

cI

PoPSout

PoPSin

LacI

Device/System Interface
po lymerase p er s econd pops

PoPSOUT

PoPSIN

cI

T

RBS

l cI

Ol

Polymerase Per Second = PoPS!

T

RBS

l cI

Ol

po lymerase p er s econd pops1

PoPSOUT

PoPSOUT

PoPSIN

PoPS Source (Any)

INVERTER

PoPSOUT

PoPSIN

Polymerase Per Second = PoPS!

PoPSOUT

PoPSIN

T

RBS

l cI

Ol

cI

device system interface4

A  B

inverter

C  D

inverter

E  F

inverter

A

C

E

B

D

F

Device/System Interface

Systems

X

Devices

device system interface5

A

B

C

Device/System Interface

Systems

X

A

PoPSOUT

Devices

PoPSIN

B

PoPSOUT

PoPSIN

C

PoPSOUT

PoPSIN

slide22

Systems

PoPS

NOT.1

PoPS

NOT.2

PoPS

NOT.3

‘Can I have

three inverters?’

‘Here’s a set of PDP inverters, 1N, that each send and receive via a fungible signal carrier, PoPS.’

PoPS

NOT.1

Devices

PoPS

PoPS

‘I need a few DNA

binding proteins.’

‘Here’s a set of DNA binding

proteins, 1N, that each recognize a unique cognate DNA site, choose any.’

Parts

‘Get me this DNA.’

DNA

‘Here’s your DNA.’

TAATACGACTCACTATAGGGAGA

Zif268, Paveltich & Pabo c. 1991

characterization and debug
Characterization and Debug

Trigger Test Circuit

slide28

From: XXXX

Subject: Endy Letter

Date: January 6, 2005 9:45:17 AM EST

To: endy@mit.edu

Dr. Endy,

I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated…

…I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent.

-Sincerely,

XXXX XXXX

XXXX High School

-Grade 10

slide32

UT 2004 SB Competition Team

Light  PoPS

Receiver

BBa_I15010

BBa_R0082

Photons

PoPS  Color

Converter

BBa_B0034

BBa_E0033

BBa_B0015

PoPS

c/o Jeff Tabor

slide33

UT 2004 SB Competition Team

Lens ripped off of overhead projector

Pile of cells/agar

Casserole dish

Thermostable chassis

c/o Jeff Tabor