1 / 3

Primer Set Euk1f & Eukr for PCR Cloning in Eukarya Research

Utilize the Euk1f and Euk516r primers for DGGE in Eukarya studies, following Medlin et al.'s protocols from 1988. Study picoeukaryotic succession in Blanes'98 using these specific primers.

tyrone-strong
Download Presentation

Primer Set Euk1f & Eukr for PCR Cloning in Eukarya Research

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PCR conditions Cloning Set of primers used Euk1f and Eukr Euk516 R DGGE Set of primers used Euk1f and Euk516r-GC Euk1F EukR

  2. Name Specificity Reference Sequence (5´ to 3´) E.coli positions EukA Eukarya Medlin et al 1988 AACCTGGTTGATCCTGCCAGT 1-21 Euk r Eukarya Medlin et al 1988 TGATCCTTCTGCAGGTTCACCTAC 1511-1535 Euk516r-CG Eukarya ACCAGACTTGCCCTCC 516-501

  3. Picoeukaryotic succession in Blanes´98

More Related