slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Supported by a grant from the Alfred P. Sloan Foundation PowerPoint Presentation
Download Presentation
Supported by a grant from the Alfred P. Sloan Foundation

Loading in 2 Seconds...

play fullscreen
1 / 39

Supported by a grant from the Alfred P. Sloan Foundation - PowerPoint PPT Presentation


  • 67 Views
  • Uploaded on

Supported by a grant from the Alfred P. Sloan Foundation. What is the Urban Barcode Project (UBP)?. UBP is a way for NYC high school students to take part in a global effort to identify living things A chance to explore the living environment in NYC

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Supported by a grant from the Alfred P. Sloan Foundation' - tristram-davies


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

What is the Urban Barcode Project (UBP)?

  • UBP is a way for NYC high school students to take part in a global effort to identify living things
  • A chance to explore the living environment in NYC
  • An opportunity to compete for $20,000 in prizes
slide3

What is DNA barcoding

and why is it important?

slide4

DNA barcodes identify species

Organism is sampled DNA is extracted “Barcode” amplified

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Sequenced DNA creates a unique “barcode” for each species

slide5

How many species can you name?

How many animals did you name?

How many mammals?

How many plants?

How many insects?

“Dog”

Canis lupus familiaris

“Shark”

Ginglymostoma cirratum

“Beetle”

Popillia japonica

“Cat”

Felis catus

“Oak Tree”

Quercus alba

slide7

Currently between 1.5 and 2 million species aredescribed/known

  • This number may represent as little as half of the true number of species
  • Perhaps more than 1/3 of all species are threatened (IUCN Red list version 2010.1)
slide9

Defining “species” is complex and

  • depends on many factors:
  • Interbreeding capabilities
  • Morphological variation
  • Ecological context
  • Genetic similarities

Canis lupus

Canis lupus (familiaris)

Anas platyrhynchos

slide11

Issue #3: Traditional taxonomic identification methods may be

inadequate/too slow to capture vanishing biodiversity.

slide12

Classical taxonomy is difficult for non-experts to understand

The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia).  Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra.  The integument is often densely punctured and may be glabrous or bear short, fine recumbentsetae.  Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed

Adding to the complexity: immature, damaged, or incomplete specimen may make identification impossible.

slide13

How barcoding works

Organism is sampled DNA is extracted “Barcode” amplified

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Sequenced DNA is compared with a barcode database

slide14

Why DNA barcoding works:

genes with the right number of differences.

CHLOROPLAST

MITOCHONDRION

matK

rbcL

CO1

slide15

Why DNA barcoding works: differences allow identification

Win: Sequence shows ~70% conservation, good for PCR, good as barcode

Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode

Fail: Sequence shows no conservation, impossible for PCR, but good as barcode

slide17

DNA barcoding is engaging in the classroom, and directs curiosity to opportunities for practical inquiry…

slide18

Kate Stoeckle

August 23, 2008

slide21

1. Students will convene in teams and design projects that use DNA barcoding to answer a question

slide22

Who can enter the competition?

  • Competition is open to NYC high school students enrolled in grades 9–12.
  • Student teams consist of either 9th-10th or 11th -12th graders.
  • Team members do not have to be from the same school.
  • Teams of 2–4 students must be sponsored by a qualifying science teacher or mentor.
  • Sponsors do not have to be from the same school as any of the students.
slide23

How can a teacher sponsor qualify?

  • Prospective sponsors must participate in a six-hour training conducted by the DNA Learning Center (DNALC) in its Harlem DNA Lab. (A $150 stipend is available for teachers participating in the training.)
  • A teacher oversees his/her students’ project.
  • Sponsors can work with up to five student teams.
  • Student project proposals are only accepted if sponsor has completed the official DNALC training.
  • Training can be taken at the Harlem DNA Lab or other locations. See UBP website for dates.
  • Participants must register through the UBP website.
slide24

What will teacher training entail?

  • Background information on DNA barcoding.
  • Detailed hands on instruction on how to extract DNA, perform PCR, conduct agarose gel analysis, get DNA samples sequenced and analyze sequences.
  • Instruction in bioinformatics and the use of the sequence analysis platform DNA Subway.
  • Assistance with proposal ideas and outlines
slide25

Who can be a science mentor?

  • Science mentors can be postdoctoral fellows, graduate students, undergraduate students under supervision (e.g. university professors), or research fellows working in a university or a research institution/organization.
  • Each team will be provided with a mentor who acts as an advisor in monitoring the project’s progress.
  • Mentors have the option of participating in a six-hour training conducted by the DNA Learning Center (DNALC) in its Harlem DNA Labor at other locations. See UBP website for dates. (A $150 stipend is available for mentors participating in the training.)
  • All participants must register through the UBP website.
slide26

2. Student teams will enter UBP by

submitting a research/project proposal

slide27

What research questions could students ask?

Research questions can be about any living thing or about non-living things (foods or other products) that have DNA.

Examples:

  • Are there invasive (non-native) plants in my local park?
  • What are the most popular types of flowers in my city?
  • Do the teas I buy at my supermarket really contain the
  • ingredients on the package?
  • How many different living organisms can I find in an office building?
slide28

Proposals are accepted during

one of two submission windows

June 1-15, 2011 (Round I)

October 1-15, 2011 (Round II)

slide29

Proposals should include:

  • An introduction to the question, describing why your question is original, creative, and relevant. You should also have references to previous research, e.g. examples of DNA barcoding used to answer a similar question.
  • An explanation of the the goals of your project, and what you plan to achieve.
  • Methods, including how samples will be collected and processed.
  • Brief biographies and personal information for each team member.
slide31

Project Workflow

Collect Samples

(Leaves, Insects, Foods, etc. )

Do DNA Barcoding Experiment

Get Results and Make Conclusions

slide32

You will have access to all the materials you need for the

  • DNA barcoding component of your experiment
  • DNA extraction kit
  • PCR machine and reagents
  • DNA sequencing
  • Bioinformatic tools (analysis of DNA sequence)
slide33

The DNA barcoding equipment is safe and easy to use, and the experiments can be done in a few hours depending on the number of samples

slide34

Materials and equipment are

  • provided to participating teams:
  • Either: by attending “Open Lab” days held
  • in NYC at sites including:
  • - Harlem DNA Lab
  • - New York Academy of Sciences
  • - American Museum of Natural History
  • - The Rockefeller University
  • - Others (TBA)
  • Or: by borrowing it from the UBP.
slide35

You will have access to online tools to

help you analyze your results

slide38

Summary

  • Form a team of 2-4 NYC high school students and a qualifying science teacher or mentor (sponsor).
  • Develop a project proposal.
  • Go to www.urbanbarcodeproject.org and submit your proposal online by the next deadline.
  • Proposals will be judged for originality, creativity, relevance, plausibility, and scientific merit. The top teams from each round of submissions will be invited to compete in the Urban Barcode Project.
  • Invited competitors must complete their projects by Spring 2012 and present their work at a project symposium.
slide39

Follow us Online

www.urbanbarcodeproject.org

Latest news and announcements posted first to:

www.facebook.com/urbanbarcodeproject

twitter.com/urbanbarcode